Special Feature

User Panel

My Panel

My Panel

Bookmark Science Articles

Recent News
Bookmark / Share This Science Site

Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification.

Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification. Research Abstract Details 

Research Abstract Table of Contents

Jump to the:

  • Abstract Text of This Paper
  • Journal Published
  • MeSH Keywords of This Abstract
  • Chemicals and Substances Used in this Paper
  • Grants and Granting Agency of this Research
  • Database Accession Numbers Used in this Paper
  • Related Papers
  • Related Research Tags
  • Rate this Research Paper
  • Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification. Abstract Text:

    alexander a chernonosovAlexander A Chernonosov,vladimir v kovalVladimir V Koval,dmitrii g knorreDmitrii G Knorre,alexander a chernenkoAlexander A Chernenko,valentina m derkachevaValentina M Derkacheva,eugenii a lukyanetsEugenii A Lukyanets,olga s fedorovaOlga S Fedorova,

    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2) (-), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)-G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.

    Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification. Publishing Authors By Initials

    aa chernonosovAA Chernonosov,vv kovalVV Koval,dg knorreDG Knorre,aa chernenkoAA Chernenko,vm derkachevaVM Derkacheva,ea lukyanetsEA Lukyanets,os fedorovaOS Fedorova,

    For similar abstracts research abstracts see: abstracts research

    PUBMED ID PMID:

    MEDLINE DATE:

    Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification. Journal Published:

    PUBLICATION TYPE: Journal Article

    Journal: Bioinorganic chemistry and applications

    VOLUME:

    Page Numbers: 63703

    Journal Abbreviation:

    ISSN: 1565-3633

    DAY: 19

    MONTH: 02

    YEAR: 2006

    Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification. Information

    Number of References:

    LANGUAGE: eng

    NlmUniqueID: 101200445

    Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification. Keywords Mesh Terms:

    KEYWORDS:

    MESH TERMS:

    Chemical & Substance for Abstract: Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification. Information

    Substance Name:

    Registry Number:

    Grant and Affiliation Information for Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification.

    AFFILIATION: Institute of Chemical Biology and Fundamental Medicine, Siberian Division of the Russian Academy of Sciences, Lavrentyev Avenue 8, Novosibirsk 630090, Russia.

    Country: Egypt

    Egypt Research PublicationEgypt Research Publication

    AGENCY:

    GRANT:

    ACRONYM:

    MEDLINETA: Bioinorg Chem Appl

    REFSOURCE:

    DATABASENAME:

    ACCESSION NUMBER:

    Number Hits: 0

    Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification Related Publications

     

    Molecular Station USER Menu

    Welcome to Molecular Station!

    You have to register before you can post on our forums or use our advanced features. Register Now! Its Free and Fast!

    Already registered? Login now below.

    User Name:

    Password:

    Already registered and Forgot your password? Click below to recover it.

    Recover Lost Password

    Join now - it's fast and free!

    Molecular Station is THE largest network of researchers, scientists and science lovers anywhere!

    Research Terms of Usage and Disclaimer
    Home
    Features

    Protocols

    DNA Forum

    Science Forum

    DNA Forum
    Biology Forum

    Science News


    [CaRP] XML error: Invalid document end at line 2

    For more click here:Science News