Intracellular StationsAntibodyBotany Chemistry Common Buffers Buffers Alphabetic Bookstore Cell Biology and Culture Gel Electrophoresis Histology Microarrays Immunology Mass Spectrometry Microbiology Molecular Imaging Peptide Protein Microarray Chips PCR Real-Time PCR RNAi and SiRNA Stem Cell Biology Transfection Western Blot |
User PanelMy PanelMy PanelBookmark Science Articles
|
||||
Can the bond between proline's amine end with another amino acid be called a ...
bond? If not, does that explain why in biuret reaction, by using casein (which contain more proline) I got less intense violet coloration in...
Please help: If a peptide occurs in one of your cells that is 50 amino acids ...
If a peptide occurs in one of your cells that is 50 amino acids long, what is the minimum number of nucleotides that would have been required for...
Double stranded DNA sequence show a gene encoding a small peptide.The...
...three stop codons are UAA,UAG, and UGA? 5'ATGACGTATAATCACCGTAGATAACAGTAATTGATAAATCAG 3'
3'TACTGCATATTAGTGGCATCTATTGTCATTAACTATTTAGTC 5'
How...
Out of aldosterone, angiotensin II, antidiuretic hormone, and atrial...
...natriuretic peptide, what lower...? Out of aldosterone, angiotensin II, antidiuretic hormone, and atrial natriuretic peptide, what lower blood...
Peptide synthesis in the solid phase?
Hello YA,
I am writing a paper on SPPS for a 4th year organic chemistry course and have finally run into a brick wall.
All of the abstracts...
You must REGISTER NOW to post a question in the Peptide Forum by clicking 
here.
List Your Peptide Products and Company in the Product Directory for FREE by Registering Your Company Here!
At Molecular Station Peptides you will find information and links on:
Also visit Peptide Station.
Recently there has been an explosion of peptide utilization in all science fields, thus the growing demand for the synthesis of synthetic peptides. Peptide have been proved to act as great probes for the study of protein-protein interactions, the binding of ligands to the extracellular domains of cell surface proteins and receptors, studying epitopes in immunology or antibody-antigen interactions, the study of inhibitory peptides on protein functions such as inhibition of cancer-inducing proteins, and enzyme-protein substrate interactions to mention a few. Also the design and application of fluorescent substrate-based peptides can be used to determine the selectivity and activity of peptidases.
Synthetic peptides can be utilized as probes in all the previously mentioned scenarios as they all involve amino acid residue interactions . Although many of these protein interactions often involve amino acid residues from distant protein domains, there are many examples where short stretches of amino acids are vital for protein-protein interactions (acting as contiguous epitopes) and thus allow the application and the use of synthetic peptides for the study of a broad range of biological phenomena.
The creation of antibodies specific for a protein is quickly done using peptides. Peptides will not fold similarly to native proteins (due to their smaller size and lack of many native residues), however they can be useful in the generation of antibodies.
Findings in Early TB Infection
New Genetic Evidence for First Americans
Reduced Colorectral Cancer Risk With Hormone Therapy
Childhood Trauma Connection and Risk for Chronic Fatigue Syndrome
Dual Role Gene Plays Part in Breast Cancers with Poor Prognosis
Insight Into Aggressive Childhood Cancer
New Genetic Markers for Ulcerative Colitis
Novel Glioblastoma Mouse Model
New Way To Fuse Cells
Aquaculture Growth ContinuingFor more click here:Science News
![[أربيك]](http://www.molecularstation.com/translate/images/flag_ar.gif){kind=small}
