Special Feature

User Panel

My Panel

My Panel

Bookmark Science Articles

Recent News
Bookmark / Share This Science Site

PCR

Polymerase Chain Reaction

In our opinion the most important methodological invention in molecular biology has been the polymerase chain reaction (PCR) as it has allowed a literal explosion of molecular biology and genetics advancements through the cloning of genes.

PCR Articles

PCR Troubleshooting

PCR History

PCR Primer Design

Primer Extension

PCR Enzymes

Factors for Successful PCR

PCR Based Site Directed Mutagenesis

Analysis of PCR Reactions

Real Time PCR

PCR Forum Topics

help! establishing primers with endonucleases, overhang and codons I have chosen these primers: left: 5' GATGTTTAGTGTTGTGGTTGC 3' and right: 5' CCGCACCAAAGAGGAAGTAT 3' and endonucleases XhoI and NdeI and these...
Real Time PCR product size I have read that the optimal product size for the Real Time PCR is 75-150 bp. With the primers that I have picked, my product will be ~290 bp long. I...
Real-time PCR statistics I have a question regarding how to do statistics on real-time PCR data. Let's say I am treating cells with inhibitor X and measuring expression of...
Fecal DNA PCR not working Hi, I am doing genotyping of wild ass fecal DNA.The PCR program I use for amplifying genomic DNA for microsatellite genotyping is: 95 deg celsius,...
No primers visible on the end of a agarose gel Dear, we are doing PCR on plant templates with different polymerases. One of our template gives a less efficiency than last year. We thought...
You must REGISTER NOW to post a question in the PCR Forum by clicking here.

View More PCR discussions and troubleshooting in the: PCR Forum

PCR Encyclopedia

PCR Pictures

Welcome Back, Unregistered !


Upload Photos

PCR Newsletter

Yes! I Want to Learn the Latest in PCR-related Research and receive Email Alerts on new PCR products and services!
Don't Worry Your Email is Safe with Us. We hate Spam as Much as You Do.  You can unsubscribe at any time by clicking on unsubscribe on the bottom of Every Email!
First Name:
Email:

We really recommend you read our excellent review of the History of the Polymerase Chain Reaction (PCR)

PCR is a primer-mediated enzymatic amplification of specifically cloned or genomic DNA sequences.  It has become a routine procedure in every molecular biology lab for manipulating and identifying genetic material.  New applications have now been generated with remarkable regularity.  These applications are transforming molecular biology.
In the post genomic era, PCR had become the method of choice to clone existing genes and generate a wide array of new genes by mutagenesis and recombination within the genes of interest.  The quick and easy availability of these genes is crucial for the study of functional genomics, protein structure function relationships, protein engineering, protein protein interactions, gene expression and essentially molecular evolution.

 

Diagram 1 - PCR Cycle Steps

PCR

Steps in a PCR Reaction

There are 3 steps in one PCR cycle reaction (see diagram 1 - PCR Cycle Steps). In step 1, the DNA is denatured at high temperatures (from 90 - 97 degrees celcius). In step 2, primers anneal to the DNA template strands to prime extension. In step 3, extension occurs at the end of the annealed primers to create a complementary copy strand of DNA. This effectively doubles the DNA quantity through the 3 steps in the PCR cycle. This cycle can repeat indefinitely theoretically, however normally constitutes 25-40 cycles.

 

 

PCR Guidelines:

For a successful PCR you need the following (read the following articles to improve and learn PCR):

Template DNA or sample starting material

PCR primers

PCR Enzymes

Factors for a Successful PCR

Post-PCR Analysis:

Troubleshooting PCRs

Analysis of PCR Reactions

 

Please read our review of the History of PCR

Articles and Information on PCR

PCR Polymerases

Avoiding PCR Contamination

PCR Primer Design Guidelines and Software

Review on the History and Development of the Polymerase Chain Reaction (PCR)

Also visit PCR Station

pcr

Polymerase Chain Reaction - PCR

Other Types of PCR - Related:

Real-Time PCR

 

DNA Menu

PCR
PCR Forum

PCR Articles

PCR Troubleshooting

PCR History

PCR Primer Design

Primer Extension

PCR Enzymes

Factors for Successful PCR

PCR Based Site Directed Mutagenesis

Analysis of PCR Reactions

Real Time PCR

PCR Protocols

PCR Protocols

PCR NEWSLETTER GROUP!!

Master the PCR Technique with our PCR Newsletter covering the latest PCR methods, Protocols, Discussions and Troubleshooting, and PCR products to help you with your PCR!

FirstName:
Email:

Note: We will only send you PCR related information not spam.We hate spam as much as you do and You can unsubscribe at any time.