Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Animal and Molecular Model Systems > Yeast Forum
Register Search Today's Posts Mark Forums Read

Yeast Forum Discuss research on yeast the model organism. Post questions and topics on the molecular biology and genetics of Saccharomyces cerevisiae and other yeast species.


please tell me what is the shortest active fragment of pgk

please tell me what is the shortest active fragment of pgk - Yeast Forum

please tell me what is the shortest active fragment of pgk - Discuss research on yeast the model organism. Post questions and topics on the molecular biology and genetics of Saccharomyces cerevisiae and other yeast species.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 07-04-2003, 04:45 AM
[gb2312] shude yang
Guest
 
Posts: n/a
Default please tell me what is the shortest active fragment of pgk



Hello:

I have spent half a year to modify a expression vector
of yeast. A important part of work was to insert a
promoter of phosphoglycerate kinase (PGK) and a PGK
terminator into pFL39.However, after having inserted a
630bp- length fragment of PGK promoter drevied from
another vector, I found that there were various kind
of PGK promoters with different length in database,
such as of 1484bp, 1496bp, 603bp, 400bp(it is called
active site of PGK promoter) fragment. Therefore, I am
anxiously worried about whether the PGK promoter of
603bp which I used in my work is active enough to
initiate transcription. As knowing little about the
characteristics of promoter structure, I hope you can
give a urgent help. The sequence of PGK promoter I
used is showed as follows:



CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGAT AATTACTTCCTTGATGATCTGTAAAAAAGAGAAAAAGAAAGCATCTAAGA ACTTGAAAAACTACGAATTAGAAAAGACCAAATATGTATTTCTTGCATTG ACCAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTC TACTAAACTAAACCACCCCCTTGGTTAGAAGAAAAGAGTGTGTGAGAACA GGCTGTTGTTGTCACACGATTCGGACAATTCTGTTTGAAAGAGAGAGAGT AACAGTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATA GCATGTGGTACTAAACCCTTTCCCGCCATTCCAGAACCTTCGATTGCTTG TTACAAAACCTGTGAGCCGTCGCTAGGACCTTGTTGTGTGACGAAATTGG AAGCTGCAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTC AGTTTTGTTCTTTTTGCAAACAAATCACGAGCGACGGTAATTTCTTTCTC GATAAGAGGCCACGTGCTTTATGAGGGTAACATCAATTCAAGATCTGAAT TCC



Thank you very much

Shude Yang
______________O_________oO_____________oO______o__ _____oO___________________
YEAST bionet newsgroup see: [Only registered users see links. ]
YEAST e-mail: messages sent to [Only registered users see links. ]
subscribe: mailto:[Only registered users see links. ].net and say: subscribe yeast
unsubscribe: mailto:[Only registered users see links. ].net and say: unsubscribe yeast
YEAST on the WWW: [Only registered users see links. ]
Newsgroup Moderator SGD Curators: [Only registered users see links. ]



Reply With Quote
Reply

Tags
active , fragment , pgk , shortest


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
2.2 fragment kb into 2.6 kb vector - Please help randi912d Molecular Cloning Forum 0 02-25-2010 12:53 AM
Isolation of gel fragment jorle Protocols and Methods Forum 1 07-14-2008 07:30 PM
New 3D-Match and 3D-MatchDB FAST Structural alignment on line victor@softberry.com Protein Forum 0 04-07-2006 03:13 AM
3D-Match and 3D-MatchDB FAST Structural alignment on line webmaster@softberry.com Protein Forum 0 03-20-2006 10:37 PM
please tell me what is the shortest active fragment of pgk promoter of yeast shude yang Protocols and Methods Forum 1 07-04-2003 04:25 AM


All times are GMT. The time now is 03:55 AM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.16366 seconds with 16 queries