| | |||||||
| Register | Search | Today's Posts | Mark Forums Read |
| Yeast Forum Discuss research on yeast the model organism. Post questions and topics on the molecular biology and genetics of Saccharomyces cerevisiae and other yeast species. |
| | LinkBack | Thread Tools | Display Modes |
|
#1
| |||
| |||
| Hello: I have spent half a year to modify a expression vector of yeast. A important part of work was to insert a promoter of phosphoglycerate kinase (PGK) and a PGK terminator into pFL39.However, after having inserted a 630bp- length fragment of PGK promoter drevied from another vector, I found that there were various kind of PGK promoters with different length in database, such as of 1484bp, 1496bp, 603bp, 400bp(it is called active site of PGK promoter) fragment. Therefore, I am anxiously worried about whether the PGK promoter of 603bp which I used in my work is active enough to initiate transcription. As knowing little about the characteristics of promoter structure, I hope you can give a urgent help. The sequence of PGK promoter I used is showed as follows: CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGAT AATTACTTCCTTGATGATCTGTAAAAAAGAGAAAAAGAAAGCATCTAAGA ACTTGAAAAACTACGAATTAGAAAAGACCAAATATGTATTTCTTGCATTG ACCAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTC TACTAAACTAAACCACCCCCTTGGTTAGAAGAAAAGAGTGTGTGAGAACA GGCTGTTGTTGTCACACGATTCGGACAATTCTGTTTGAAAGAGAGAGAGT AACAGTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATA GCATGTGGTACTAAACCCTTTCCCGCCATTCCAGAACCTTCGATTGCTTG TTACAAAACCTGTGAGCCGTCGCTAGGACCTTGTTGTGTGACGAAATTGG AAGCTGCAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTC AGTTTTGTTCTTTTTGCAAACAAATCACGAGCGACGGTAATTTCTTTCTC GATAAGAGGCCACGTGCTTTATGAGGGTAACATCAATTCAAGATCTGAAT TCC Thank you very much Shude Yang ______________O_________oO_____________oO______o__ _____oO___________________ YEAST bionet newsgroup see: [Only registered users see links. ] YEAST e-mail: messages sent to [Only registered users see links. ] subscribe: mailto:[Only registered users see links. ].net and say: subscribe yeast unsubscribe: mailto:[Only registered users see links. ].net and say: unsubscribe yeast YEAST on the WWW: [Only registered users see links. ] Newsgroup Moderator SGD Curators: [Only registered users see links. ] |
| Tags |
| active , fragment , pgk , shortest |
| Thread Tools | |
| Display Modes | |
|
|
| | ||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| 2.2 fragment kb into 2.6 kb vector - Please help | randi912d | Molecular Cloning Forum | 0 | 02-25-2010 12:53 AM |
| Isolation of gel fragment | jorle | Protocols and Methods Forum | 1 | 07-14-2008 07:30 PM |
| New 3D-Match and 3D-MatchDB FAST Structural alignment on line | victor@softberry.com | Protein Forum | 0 | 04-07-2006 03:13 AM |
| 3D-Match and 3D-MatchDB FAST Structural alignment on line | webmaster@softberry.com | Protein Forum | 0 | 03-20-2006 10:37 PM |
| please tell me what is the shortest active fragment of pgk promoter of yeast | shude yang | Protocols and Methods Forum | 1 | 07-04-2003 04:25 AM |