Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > RNA Techniques Forum > RNAi and SiRNA Forum
Register Search Today's Posts Mark Forums Read

RNAi and SiRNA Forum Discuss and Post Questions in this forum about RNA interference and siRNA. RNAi and siRNA transfection, inhibition of endogenous genes, and miRNA and shRNA.


Design an RNAi that targets the following gene?

Design an RNAi that targets the following gene? - RNAi and SiRNA Forum

Design an RNAi that targets the following gene? - Discuss and Post Questions in this forum about RNA interference and siRNA. RNAi and siRNA transfection, inhibition of endogenous genes, and miRNA and shRNA.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 11-14-2012, 08:15 PM
Pipette Filler
Points: 6, Level: 1 Points: 6, Level: 1 Points: 6, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Nov 2012
Posts: 1
Thanks: 0
Thanked 0 Times in 0 Posts
Default Design an RNAi that targets the following gene?



ATGGGCATGGTCATTACGGTTAGCATTAGGCACTAATCCGCGTAGGCATG CG

I don't know where to start. That's simply all I got for the question.
Reply With Quote
  #2  
Old 11-14-2012, 08:16 PM
Pipette Filler
Points: 533, Level: 10 Points: 533, Level: 10 Points: 533, Level: 10
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Apr 2008
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Default

Uacccguaccaguaaugccaaucguaauccgugauuaggc
Reply With Quote
Reply

Tags
design , gene , rnai , targets


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Human Cytome Project - Update 24 Jan. 2005 Peter Van Osta Cell Biology and Cell Culture 1 08-01-2010 02:18 PM
New Saccharomyces Sequences 11/27/04 Mike Cherry Yeast Forum 0 11-28-2004 11:39 PM
New Saccharomyces Sequences 09/08/04 SGD Sequences Yeast Forum 0 09-13-2004 10:07 PM
New Saccharomyces Sequences 08/11/04 SGD Sequences Yeast Forum 0 08-12-2004 12:26 AM
New Saccharomyces Sequences 05/19/04 SGD Sequences Yeast Forum 0 05-23-2004 04:06 PM


All times are GMT. The time now is 02:25 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.20441 seconds with 16 queries