Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (http://www.molecularstation.com/forum/)
-   RNAi and SiRNA Forum (http://www.molecularstation.com/forum/rnai-sirna-forum/)
-   -   Design an RNAi that targets the following gene? (http://www.molecularstation.com/forum/rnai-sirna-forum/86810-design-rnai-targets-following-gene.html)

Bumblebee 11-14-2012 09:15 PM

Design an RNAi that targets the following gene?
 
ATGGGCATGGTCATTACGGTTAGCATTAGGCACTAATCCGCGTAGGCATG CG

I don't know where to start. That's simply all I got for the question.

saku 11-14-2012 09:16 PM

Uacccguaccaguaaugccaaucguaauccgugauuaggc


All times are GMT. The time now is 04:20 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.08853 seconds with 11 queries