Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > RNA Techniques Forum
Register Search Today's Posts Mark Forums Read

RNA Techniques Forum Post and discuss RNA methods and RNA science related topics. RNA extraction, cDNA synthesis, RNA EMSA, and other RNA protocols.

siRNA vs miRNA

siRNA vs miRNA - RNA Techniques Forum

siRNA vs miRNA - Post and discuss RNA methods and RNA science related topics. RNA extraction, cDNA synthesis, RNA EMSA, and other RNA protocols.

LinkBack Thread Tools Display Modes
Old 05-18-2009, 04:04 PM
Pipette Filler
Points: 949, Level: 17 Points: 949, Level: 17 Points: 949, Level: 17
Activity: 0% Activity: 0% Activity: 0%
Join Date: Aug 2008
Location: pakistan
Posts: 24
Thanks: 5
Thanked 0 Times in 0 Posts
Default siRNA vs miRNA

Hi friends,

Tell me whether siRNA based gene silencing is more effective or miRNA based.How miRNA gene silencing is activated and siRNA is? Thanks.
Reply With Quote
Old 05-19-2009, 05:04 PM
Jon Moulton's Avatar
Points: 8,875, Level: 65 Points: 8,875, Level: 65 Points: 8,875, Level: 65
Activity: 0% Activity: 0% Activity: 0%
Join Date: May 2007
Location: Corvallis, OR, USA
Posts: 256
Thanks: 3
Thanked 15 Times in 15 Posts
Default Re: siRNA vs miRNA

Originally Posted by Barbienidoo View Post
Hi friends,

Tell me whether siRNA based gene silencing is more effective or miRNA based.How miRNA gene silencing is activated and siRNA is? Thanks.

Hi Barbienidoo,

OK, I'll undertake some careful definitions; assuming we agree on these, I'll try a few statements which might useful.

First we need to understand what you mean by siRNA and miRNA. As I understand it, when double stranded RNA is introduced into cells as oligos it is siRNA. When it is introduced as hairpins (shRNA) that is also a class of siRNA. I think hairpin RNA that forms though transcription from an exogenous plasmid and then is processed by Drosha and Dicer and loaded onto RISC is also considered a form of siRNA.

However, when a RNA is transcribed from a chromosome, forms a stem-loop and is processed by Drosha and Dicer and loaded onto RISC, this is called a miRNA.

The difference is in where the RNA comes from. Transcription from endogenous DNA can produce miRNA, transcription from exogenous DNA can form siRNA and introduction of hairpins or dsRNA oligos are also forms of siRNA.

Now, if that matches your definitions of siRNA and miRNA then we can say that either is as effective against their targets once they are loaded onto the RISC; after all, RNA is RNA. Efficacy of loading might differ between dsRNA oligos and shRNA, as cleavage by Dicer is thought to position the new dsRNA for efficient loading onto RISC. The degree of complementarity with MRE on mRNAs will affect efficacy of knockdown.

Both miRNA and siRNA will modulate expression of many genes; in the case of miRNA, this network of gene modulation is tuned by natural selection while in the case of siRNA, you may get unanticipated effects. The RNA is just RNA regardless of where it comes from, but the endogenous sequences have evolved relationships with the transcriptome while the exogenous sequences trigger surprises.

Here are some citations that address the off-target gene modulation encountered with siRNA and the networks of gene modulation controlled by miRNA. siRNA is an effective system for achieving about 80% knockdown of a target gene, but be careful with your controls!

Widespread changes in protein synthesis induced by microRNAs. Selbach M, Schwanhäusser B, Thierfelder N, Fang Z, Khanin R, Rajewsky N. Nature. 2008 Jul 30. [Epub ahead of print]

Comparison of siRNA-induced off-target RNA and protein effects. Aleman LM, Doench J, Sharp PA. RNA. 2007 Jan 19; [Epub ahead of print]

Nonspecific, concentration-dependant stimulation and repression of mammalian gene expression by small interfering RNAs (siRNAs). Persengiev SP, Zhu X and Green M. RNA 2004; 10:12-18.

Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Scacheri PC, Rozenblatt-Rosen O, Caplen NJ, Wolfsberg TG, Umayam L, Lee JC, Hughes CM, Shanmugam KS, Bhattacharjee A, Meyerson M, Collins FS. Proc Natl Acad Sci U S A. 2004 Feb 17;101(7):1892-7. Epub 2004 Feb 09.

Small RNAs with Imperfect Match to Endogenous mRNA Repress Translation: Implications for off-target activity of small inhibitory RNA in mammalian cells. Saxena S, Jonsson ZO, Dutta A. J Biol Chem. 2003 Nov 7;278(45):44312-44319.
Jon D. Moulton, Ph.D.
Gene Tools, LLC
[Only registered users see links. ]
Reply With Quote
Old 11-22-2011, 01:18 PM
kum kum is offline
Pipette Filler
Points: 1,271, Level: 20 Points: 1,271, Level: 20 Points: 1,271, Level: 20
Activity: 0% Activity: 0% Activity: 0%
Join Date: Feb 2010
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: siRNA vs miRNA

Hello, I read that antisense strand of sirna actually binds with mRNA, but please look at the following example from Tuschl lab page.

Human lamin B1
targeted region (cDNA): 5' AACGCGCTTGGTAGAGGTGGATT (1)

here antisense siRNA is complimentary to the cDNA, so it could not bind to mRNA, in fact sense strand of the siRNA binds to mRNA??

Please correct me if I am wrong,
There are some more examples on Tuschl lab pagerockefeller.edu/labheads/tuschl/sirna.html).

Reply With Quote
Old 12-02-2011, 03:56 PM
Jon Moulton's Avatar
Points: 8,875, Level: 65 Points: 8,875, Level: 65 Points: 8,875, Level: 65
Activity: 0% Activity: 0% Activity: 0%
Join Date: May 2007
Location: Corvallis, OR, USA
Posts: 256
Thanks: 3
Thanked 15 Times in 15 Posts
Default Re: siRNA vs miRNA

Hi Kumar,

I addressed your question here:
[Only registered users see links. ]

- Jon
Reply With Quote

mirna , sirna

Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
what are the differences between siRNA and miRNA? phone RNAi and SiRNA Forum 3 02-08-2011 01:50 PM
Differences between miRNA, shRNA, and siRNA? molecule2005 RNAi and SiRNA Forum 2 09-07-2009 06:12 AM
what is the difference between siRna and miRna? N.B RNAi and SiRNA Forum 0 10-24-2008 04:16 PM
miRNA specificity controls: paper Jon Moulton RNAi and SiRNA Forum 2 01-28-2008 08:44 PM
rational siRNA design Chang Zhu Protocols and Methods Forum 0 04-07-2004 12:13 AM

All times are GMT. The time now is 05:37 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.14815 seconds with 16 queries