Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Protocols and Methods Forum
Register Search Today's Posts Mark Forums Read

Protocols and Methods Forum Post Any Protocol, Method, Technique, Procedure or Tips / Troubleshooting for any Molecular Biology Technique.


doubt regarding agrobacterium DNA restriction digestion

doubt regarding agrobacterium DNA restriction digestion - Protocols and Methods Forum

doubt regarding agrobacterium DNA restriction digestion - Post Any Protocol, Method, Technique, Procedure or Tips / Troubleshooting for any Molecular Biology Technique.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 06-18-2008, 05:16 PM
Michael Sullivan
Guest
 
Posts: n/a
Default doubt regarding agrobacterium DNA restriction digestion



Are you trying to digest plasmid DNA from agro to make sure you have
transformed a binary vector construct?

Yield and quality of DNA from agro are usually much lower than you
would get from E. coli, so sometimes it is difficult to directly
analyze DNA isolated from agro.

I have had good luck using Qiagen plasmid minipreps. Usually, I get
DNA of good enough yield and quality to see restriction digestion
products. In the past, using simple alkaline lysis type procedures,
results were typically more variable- sometimes I could see digestion
products, sometimes not. However, I found the DNA was always of
sufficient quality to retransform into E. coli. This means that to
analyze a plasmid from agro, you may need to transform the DNA back
into E. coli, where prepping and doing a digest will be trivial. If
results of the DNA analysis from E. coli look good, you know your
plasmid in agro was OK.

Mike

On Jun 18, 2008, at 11:02 AM, priyadarsini Tripuraneni wrote:


Reply With Quote
  #2  
Old 05-06-2011, 08:57 AM
Pipette Filler
Points: 256, Level: 5 Points: 256, Level: 5 Points: 256, Level: 5
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2010
Posts: 1
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: doubt regarding agrobacterium DNA restriction digestion

NNNNGNNNNGCGATCAGCTTGGGATCGATTCTGGGCTTTCATCTCCTATC CCTCATTTTCTGGAACACTTTCATTGCCTCCTTAACATTTCCGGATTCTG AAAAAGCATTTATCATGGCATTGAAGAATATGGAGTCAGGTTTTAGTCCA TTTTGCTCCAATTTAGAGAGAAGCAACGGAATAGACTTGAAACGTTTCTG GAGAGTCAAGGCAGCCAAAACAGTTGTATATGTCACAAGAGTTGGCCGAT GTCCTTCTTCGGTAAGACCCTTGAGAATTGAGCGGACCTCTTGTGGCTTT TTCCTCTCAATCAAAATATTCATCAGTTTTGTTCTTGAGCGAACAATGTG GCAACTCGTACTTCCCCAGCAGGCAGTGCAGCGAGATTGACGTGGAGAAT TCGCCGTAGCTGAAACAAGAGGAGCTTGGTTTTCATGTCGATGAGATTCC ATGGTGTAAGATGCAAAAATCTTCGACTTGCTCGAACTTGTTCCGTTCTT TTTCTCAAAAATGATAGACTTGGCTACCTCATTTCCAAATTCTCCCATAT TTTTCTTATCCAATTCTTAATTTTACTGCTGCTTATGAATGATAGCAATA TAATTGCCTCTATTATCTATCCCGCAGAAGTTTACTGCTGCCTCAAGGAC ATTTTTCCTGTTTAGTGTGAGGGATAGGAGATGAAAGCCCAGAATCGATC ccagatctggatcccctctagagtcgacctgcaggcatgcaagcttggcg taatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaat tccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcct aatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttc cagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgc ggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactg actcgctgcgctcggtcgttcggctgcggcgagcgtatcagctcactcaa aggcggtaatacggttatccacaggatcaggggataacgcngaaagaaca tgtgagcaaaggccagcaaaggccaggancgtaaaaaggccgcCNTTGCT GGGCNNNNN
Reply With Quote
Reply

Tags
agrobacterium , digestion , dna , doubt , restriction


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
problems with restriction digestion chemophoto@gmail.com Protocols and Methods Forum 7 01-04-2012 01:00 PM
Restriction Enzyme Digestion Protocol admin DNA Techniques 1 04-13-2011 06:11 AM
doubt regarding agrobacterium DNA restriction digestion Michael J. Prigge Protocols and Methods Forum 0 06-18-2008 07:29 PM
doubt regarding agrobacterium DNA restriction digestion priyadarsini Tripuraneni Protocols and Methods Forum 0 06-18-2008 04:02 PM
Restriction Enzyme Digestion admin DNA Techniques 0 08-02-2006 09:44 AM


All times are GMT. The time now is 07:14 AM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.11933 seconds with 16 queries