Annealing temp using Quikchange SDM kit

Hi,



I’m designing my Quikchange-SDM and have a question regarding the annealing
temperature. What is the best way to determine the annealing temperature
since, in this case, primers should be designed with a minimum Tm= 78ºC? (so
the annealing temperature= Tm- 5ºC wouldn’t apply here)

Thanks for your feedback!



Clarisa

"Clarisa Bejar" <[Only registered users see links. ]> writes:


For Quikchange, both the 3' and 5' ends of the primer must bind well.
The easiest way to assure this is to pretend you are designing two
different primers, one 5' of the mutation, and a second 3' of the
mutation, and get the Tm of these primers roughtly correct. The
manual tells you what you need to know. The Tm's that any program
calculates will just confuse you, and you should ignore them. In
general, design 16-20 bp matching, surrounding the mutated region,
more if there is high GC content. You might try for high GC at the
extreme 5' and 3' ends.

In article <[Only registered users see links. ].net> , [Only registered users see links. ] wrote:

The Tm calculated by various formulas/servers/programs can vary
by 10C and more. Paying much attention to it is not worth it.

Plus, QuickChange protocol is not particularly sensitive to
annealing temperature. An example:
I used this primer recently (mismatch bracketed):
gcgcggttactctttcacgtg[c]accgctgagcgtgaaatcg

Stratagene's formula gives 86.6C
idtdna.com OligoAnalyser gives 75.3C with Mg2+=2 mM and
68.5C without Mg2+.

For reasons not related to optimization of the reaction, I did
QuickChange with this primer at 50, 55 and 60C annealing.
All worked. 55 an 60 were undistinguishable at ~ 70 percent
positives and not hugely better than 50 (50 percent positives).

Also, Stratagene's formula is not applicable to deletions. Another
example: CCATCACCATCACCATCACTCCGGT [deletion of
1.2 kbp] GGTGCAACCACTAGTGAGAATCTCTAC
Four our of six clones were positive for deletion.

My rules for QCh primer design:
1. Make "arms" of the primer having ~ same TM.
2. Make each arm having TM of 50-60C as calculated by
OligoAnalyser without Mg2+.

I only use one primer in the reaction and use "PfuUltra
Fusion II", which works much, much better than regular
Pfu or PfuUltra. The protocol:

25 ul reaction, 0.5 ul polymerase, 0.2 mM dNTPs, 0.2 uM
primer, ~ 50 ng template, 4% DMSO, annealing at 55C by
default, 30 cycles at 65C extension for ~ 1 min/kbp (that's
because PfuFusion works much faster). 1 ul DpnI +
10 ul QuickChange reaction for 2 hours, electroporate
2 ul using home-made cells.

This worked for single codon fixes, insertions of as much as
45 bp and deletions of up to 3 kbp. It also works for inserting
the whole genes (PCRed out with appropriate primers)
where the gel-purified PCR product, ~100-150 ng, is used in
place of the primer (in this case, for whatever reason,
2 min/kbp works better).

DK