Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Protocols and Methods Forum
Register Search Today's Posts Mark Forums Read

Protocols and Methods Forum Post Any Protocol, Method, Technique, Procedure or Tips / Troubleshooting for any Molecular Biology Technique.


Annealing temp using Quikchange SDM kit

Annealing temp using Quikchange SDM kit - Protocols and Methods Forum

Annealing temp using Quikchange SDM kit - Post Any Protocol, Method, Technique, Procedure or Tips / Troubleshooting for any Molecular Biology Technique.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 03-20-2008, 06:47 PM
Clarisa Bejar
Guest
 
Posts: n/a
Default Annealing temp using Quikchange SDM kit



Hi,



I’m designing my Quikchange-SDM and have a question regarding the annealing
temperature. What is the best way to determine the annealing temperature
since, in this case, primers should be designed with a minimum Tm= 78şC? (so
the annealing temperature= Tm- 5şC wouldn’t apply here)

Thanks for your feedback!



Clarisa

Reply With Quote
  #2  
Old 03-22-2008, 11:43 AM
Tom Knight
Guest
 
Posts: n/a
Default Annealing temp using Quikchange SDM kit

"Clarisa Bejar" <[Only registered users see links. ]> writes:


For Quikchange, both the 3' and 5' ends of the primer must bind well.
The easiest way to assure this is to pretend you are designing two
different primers, one 5' of the mutation, and a second 3' of the
mutation, and get the Tm of these primers roughtly correct. The
manual tells you what you need to know. The Tm's that any program
calculates will just confuse you, and you should ignore them. In
general, design 16-20 bp matching, surrounding the mutated region,
more if there is high GC content. You might try for high GC at the
extreme 5' and 3' ends.

Reply With Quote
  #3  
Old 03-22-2008, 04:13 PM
DK
Guest
 
Posts: n/a
Default Annealing temp using Quikchange SDM kit

In article <[Only registered users see links. ].net> , [Only registered users see links. ] wrote:

The Tm calculated by various formulas/servers/programs can vary
by 10C and more. Paying much attention to it is not worth it.

Plus, QuickChange protocol is not particularly sensitive to
annealing temperature. An example:
I used this primer recently (mismatch bracketed):
gcgcggttactctttcacgtg[c]accgctgagcgtgaaatcg

Stratagene's formula gives 86.6C
idtdna.com OligoAnalyser gives 75.3C with Mg2+=2 mM and
68.5C without Mg2+.

For reasons not related to optimization of the reaction, I did
QuickChange with this primer at 50, 55 and 60C annealing.
All worked. 55 an 60 were undistinguishable at ~ 70 percent
positives and not hugely better than 50 (50 percent positives).

Also, Stratagene's formula is not applicable to deletions. Another
example: CCATCACCATCACCATCACTCCGGT [deletion of
1.2 kbp] GGTGCAACCACTAGTGAGAATCTCTAC
Four our of six clones were positive for deletion.

My rules for QCh primer design:
1. Make "arms" of the primer having ~ same TM.
2. Make each arm having TM of 50-60C as calculated by
OligoAnalyser without Mg2+.

I only use one primer in the reaction and use "PfuUltra
Fusion II", which works much, much better than regular
Pfu or PfuUltra. The protocol:

25 ul reaction, 0.5 ul polymerase, 0.2 mM dNTPs, 0.2 uM
primer, ~ 50 ng template, 4% DMSO, annealing at 55C by
default, 30 cycles at 65C extension for ~ 1 min/kbp (that's
because PfuFusion works much faster). 1 ul DpnI +
10 ul QuickChange reaction for 2 hours, electroporate
2 ul using home-made cells.

This worked for single codon fixes, insertions of as much as
45 bp and deletions of up to 3 kbp. It also works for inserting
the whole genes (PCRed out with appropriate primers)
where the gel-purified PCR product, ~100-150 ng, is used in
place of the primer (in this case, for whatever reason,
2 min/kbp works better).

DK
Reply With Quote
Reply

Tags
annealing , kit , quikchange , sdm , temp


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Annealing temp selection betsycam DNA Forum 2 06-02-2010 04:23 PM
Annealing Temperatures for PCR Jayakumar, R Protocols and Methods Forum 0 03-30-2006 01:34 PM
Reakcje wodorotlenku żelaza (III) pod wpływem temp. ?? Ciseq Forum Chemia 2 12-11-2004 09:10 PM
Q: multiple bands on Quikchange Woo Cheol Lee Protocols and Methods Forum 1 12-08-2004 04:11 PM
Ligase free annealing question EK Protocols and Methods Forum 9 01-24-2004 10:15 AM


All times are GMT. The time now is 05:58 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.16662 seconds with 16 queries