Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Protocols and Methods Forum
Register Search Today's Posts Mark Forums Read

Protocols and Methods Forum Post Any Protocol, Method, Technique, Procedure or Tips / Troubleshooting for any Molecular Biology Technique.


please tell me what is the shortest active fragment of pgk promoter of yeast

please tell me what is the shortest active fragment of pgk promoter of yeast - Protocols and Methods Forum

please tell me what is the shortest active fragment of pgk promoter of yeast - Post Any Protocol, Method, Technique, Procedure or Tips / Troubleshooting for any Molecular Biology Technique.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 07-04-2003, 03:22 AM
shude yang
Guest
 
Posts: n/a
Default please tell me what is the shortest active fragment of pgk promoter of yeast



Hello:



I have spent half a year to modify a expression vector
of yeast. A important part of work was to insert a
promoter of phosphoglycerate kinase (PGK) and a PGK
terminator into pFL39.However, after having inserted a
630bp- length fragment of PGK promoter drevied from
another vector, I found that there were various kind
of PGK promoters with different length in database,
such as of 1484bp, 1496bp, 603bp, 400bp(it is called
active site of PGK promoter) fragment. Therefore, I am
anxiously worried about whether the PGK promoter of
603bp which I used in my work is active enough to
initiate transcription. As knowing little about the
characteristics of promoter structure, I hope you can
give a urgent help. The sequence of PGK promoter I
used is showed as follows:



CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGAT AATTACTTCCTTGATGATCTGTAAAAAAGAGAAAAAGAAAGCATCTAAGA ACTTGAAAAACTACGAATTAGAAAAGACCAAATATGTATTTCTTGCATTG ACCAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTC TACTAAACTAAACCACCCCCTTGGTTAGAAGAAAAGAGTGTGTGAGAACA GGCTGTTGTTGTCACACGATTCGGACAATTCTGTTTGAAAGAGAGAGAGT AACAGTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATA GCATGTGGTACTAAACCCTTTCCCGCCATTCCAGAACCTTCGATTGCTTG TTACAAAACCTGTGAGCCGTCGCTAGGACCTTGTTGTGTGACGAAATTGG AAGCTGCAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTC AGTTTTGTTCTTTTTGCAAACAAATCACGAGCGACGGTAATTTCTTTCTC GATAAGAGGCCACGTGCTTTATGAGGGTAACATCAATTCAAGATCTGAAT TCC



Thank you very much



__________________________________________________ _______
Do You Yahoo!?
国内电邮用户反垃圾调查*开帷幕
[Only registered users see links. ]
---
Reply With Quote
  #2  
Old 07-04-2003, 04:25 AM
EK
Guest
 
Posts: n/a
Default please tell me what is the shortest active fragment of pgk promoter of yeast


"shude yang" <[Only registered users see links. ].cn> wrote in message
news:[Only registered users see links. ].yahoo .com...
CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGAT AATTACTTCCTTGATGATCTGTAAAA
AAGAGAAAAAGAAAGCATCTAAGAACTTGAAAAACTACGAATTAGAAAAG ACCAAATATGTATTTCTTGCATTGAC
CAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTCTA CTAAACTAAACCACCCCCTTGGTTAG
AAGAAAAGAGTGTGTGAGAACAGGCTGTTGTTGTCACACGATTCGGACAA TTCTGTTTGAAAGAGAGAGAGTAACA
GTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATAGCAT GTGGTACTAAACCCTTTCCCGCCATT
CCAGAACCTTCGATTGCTTGTTACAAAACCTGTGAGCCGTCGCTAGGACC TTGTTGTGTGACGAAATTGGAAGCTG
CAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTCAGTTTT GTTCTTTTTGCAAACAAATCACGAGC
GACGGTAATTTCTTTCTCGATAAGAGGCCACGTGCTTTATGAGGGTAACA TCAATTCAAGATCTGAATTCC

I think since you took it from another vector that supposedly worked, your
603 bp should be fine, unless of course you mixed up something during
cloning :-). It is quite usual that people find out what are minimal
sequences that still retain function, and it might have been similar
situation with your promoter. If you are sure that you did everything
correctly, then don't worry now, but worry when it did not work the way you
expected :-).
-Emir


Reply With Quote
Reply

Tags
active , fragment , pgk , promoter , shortest , yeast


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
New Saccharomyces Sequences 09/08/04 SGD Sequences Yeast Forum 0 09-13-2004 10:07 PM
New Saccharomyces Sequences 08/11/04 SGD Sequences Yeast Forum 0 08-12-2004 12:26 AM
requesting information on yeast promoter less vector pAS 201 Martin Hirst Yeast Forum 0 09-25-2003 01:27 PM
requesting information on yeast promoter less vector pAS 201 Sreihani@aol.com Yeast Forum 0 09-19-2003 04:57 AM
please tell me what is the shortest active fragment of pgk [gb2312] shude yang Yeast Forum 0 07-04-2003 04:45 AM


All times are GMT. The time now is 12:52 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.13829 seconds with 16 queries