Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (http://www.molecularstation.com/forum/)
-   Protocols and Methods Forum (http://www.molecularstation.com/forum/protocols-methods-forum/)
-   -   please tell me what is the shortest active fragment of pgk promoter of yeast (http://www.molecularstation.com/forum/protocols-methods-forum/16756-please-tell-me-what-shortest-active-fragment-pgk-promoter-yeast.html)

shude yang 07-04-2003 03:22 AM

please tell me what is the shortest active fragment of pgk promoter of yeast
 
Hello:



I have spent half a year to modify a expression vector
of yeast. A important part of work was to insert a
promoter of phosphoglycerate kinase (PGK) and a PGK
terminator into pFL39.However, after having inserted a
630bp- length fragment of PGK promoter drevied from
another vector, I found that there were various kind
of PGK promoters with different length in database,
such as of 1484bp, 1496bp, 603bp, 400bp(it is called
active site of PGK promoter) fragment. Therefore, I am
anxiously worried about whether the PGK promoter of
603bp which I used in my work is active enough to
initiate transcription. As knowing little about the
characteristics of promoter structure, I hope you can
give a urgent help. The sequence of PGK promoter I
used is showed as follows:



CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGAT AATTACTTCCTTGATGATCTGTAAAAAAGAGAAAAAGAAAGCATCTAAGA ACTTGAAAAACTACGAATTAGAAAAGACCAAATATGTATTTCTTGCATTG ACCAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTC TACTAAACTAAACCACCCCCTTGGTTAGAAGAAAAGAGTGTGTGAGAACA GGCTGTTGTTGTCACACGATTCGGACAATTCTGTTTGAAAGAGAGAGAGT AACAGTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATA GCATGTGGTACTAAACCCTTTCCCGCCATTCCAGAACCTTCGATTGCTTG TTACAAAACCTGTGAGCCGTCGCTAGGACCTTGTTGTGTGACGAAATTGG AAGCTGCAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTC AGTTTTGTTCTTTTTGCAAACAAATCACGAGCGACGGTAATTTCTTTCTC GATAAGAGGCCACGTGCTTTATGAGGGTAACATCAATTCAAGATCTGAAT TCC



Thank you very much



__________________________________________________ _______
Do You Yahoo!?
国内电邮用户反垃圾调查*开帷幕
[Only registered and activated users can see links. Click Here To Register...]
---

EK 07-04-2003 04:25 AM

please tell me what is the shortest active fragment of pgk promoter of yeast
 

"shude yang" <[Only registered and activated users can see links. Click Here To Register...].cn> wrote in message
news:[Only registered and activated users can see links. Click Here To Register...].yahoo .com...
CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGAT AATTACTTCCTTGATGATCTGTAAAA
AAGAGAAAAAGAAAGCATCTAAGAACTTGAAAAACTACGAATTAGAAAAG ACCAAATATGTATTTCTTGCATTGAC
CAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTCTA CTAAACTAAACCACCCCCTTGGTTAG
AAGAAAAGAGTGTGTGAGAACAGGCTGTTGTTGTCACACGATTCGGACAA TTCTGTTTGAAAGAGAGAGAGTAACA
GTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATAGCAT GTGGTACTAAACCCTTTCCCGCCATT
CCAGAACCTTCGATTGCTTGTTACAAAACCTGTGAGCCGTCGCTAGGACC TTGTTGTGTGACGAAATTGGAAGCTG
CAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTCAGTTTT GTTCTTTTTGCAAACAAATCACGAGC
GACGGTAATTTCTTTCTCGATAAGAGGCCACGTGCTTTATGAGGGTAACA TCAATTCAAGATCTGAATTCC

I think since you took it from another vector that supposedly worked, your
603 bp should be fine, unless of course you mixed up something during
cloning :-). It is quite usual that people find out what are minimal
sequences that still retain function, and it might have been similar
situation with your promoter. If you are sure that you did everything
correctly, then don't worry now, but worry when it did not work the way you
expected :-).
-Emir




All times are GMT. The time now is 02:25 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.09150 seconds with 11 queries