![]() |
please tell me what is the shortest active fragment of pgk promoter of yeast Hello: I have spent half a year to modify a expression vector of yeast. A important part of work was to insert a promoter of phosphoglycerate kinase (PGK) and a PGK terminator into pFL39.However, after having inserted a 630bp- length fragment of PGK promoter drevied from another vector, I found that there were various kind of PGK promoters with different length in database, such as of 1484bp, 1496bp, 603bp, 400bp(it is called active site of PGK promoter) fragment. Therefore, I am anxiously worried about whether the PGK promoter of 603bp which I used in my work is active enough to initiate transcription. As knowing little about the characteristics of promoter structure, I hope you can give a urgent help. The sequence of PGK promoter I used is showed as follows: CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGAT AATTACTTCCTTGATGATCTGTAAAAAAGAGAAAAAGAAAGCATCTAAGA ACTTGAAAAACTACGAATTAGAAAAGACCAAATATGTATTTCTTGCATTG ACCAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTC TACTAAACTAAACCACCCCCTTGGTTAGAAGAAAAGAGTGTGTGAGAACA GGCTGTTGTTGTCACACGATTCGGACAATTCTGTTTGAAAGAGAGAGAGT AACAGTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATA GCATGTGGTACTAAACCCTTTCCCGCCATTCCAGAACCTTCGATTGCTTG TTACAAAACCTGTGAGCCGTCGCTAGGACCTTGTTGTGTGACGAAATTGG AAGCTGCAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTC AGTTTTGTTCTTTTTGCAAACAAATCACGAGCGACGGTAATTTCTTTCTC GATAAGAGGCCACGTGCTTTATGAGGGTAACATCAATTCAAGATCTGAAT TCC Thank you very much __________________________________________________ _______ Do You Yahoo!? ¹úÄÚµçÓÊÓû§·´À¬»øµ÷²éÀ*¿ªá¡Ä» [Only registered and activated users can see links. Click Here To Register...] --- |
please tell me what is the shortest active fragment of pgk promoter of yeast "shude yang" <[Only registered and activated users can see links. Click Here To Register...].cn> wrote in message news:[Only registered and activated users can see links. Click Here To Register...].yahoo .com... CCCAAGCTTACCTGCTGCGCATTGTTTTATATTTGTTGTAAAAAGTAGAT AATTACTTCCTTGATGATCTGTAAAA AAGAGAAAAAGAAAGCATCTAAGAACTTGAAAAACTACGAATTAGAAAAG ACCAAATATGTATTTCTTGCATTGAC CAATTTATGCAAGTTTATATATATGTAAATGTAAGTTTCACGAGGTTCTA CTAAACTAAACCACCCCCTTGGTTAG AAGAAAAGAGTGTGTGAGAACAGGCTGTTGTTGTCACACGATTCGGACAA TTCTGTTTGAAAGAGAGAGAGTAACA GTACGATCGAACGAACTTTGCTCTGGAGATCACAGTGGGCATCATAGCAT GTGGTACTAAACCCTTTCCCGCCATT CCAGAACCTTCGATTGCTTGTTACAAAACCTGTGAGCCGTCGCTAGGACC TTGTTGTGTGACGAAATTGGAAGCTG CAATCAATAGGAAGACAGGAAGTCGAGCGTGTCTGGGTTTTTTCAGTTTT GTTCTTTTTGCAAACAAATCACGAGC GACGGTAATTTCTTTCTCGATAAGAGGCCACGTGCTTTATGAGGGTAACA TCAATTCAAGATCTGAATTCC I think since you took it from another vector that supposedly worked, your 603 bp should be fine, unless of course you mixed up something during cloning :-). It is quite usual that people find out what are minimal sequences that still retain function, and it might have been similar situation with your promoter. If you are sure that you did everything correctly, then don't worry now, but worry when it did not work the way you expected :-). -Emir |
| All times are GMT. The time now is 04:16 AM. |
Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved