| |||||||
| Register | Blogs | FAQ | Members List | Calendar | Science Groups New! | Arcade | Search | Today's Posts | Mark Forums Read |
| Proteomics Forum Post Questions and Discuss Proteomics, Proteomic Bioinformatics, Proteomic Techniques such as 2-D, Mass Spec etc. |
 |
 |
| | LinkBack | Thread Tools | Display Modes |
06-05-2008, 01:27 AM
| |||||
| |||||
 urgent help needed in sequencing plasmid I have a certain plasmid.it has a virtual sequence. i have five primers. i am asked to find the full sequence of the plasmid.can anybody help me with this problem. I also have an insert which is th epart of the plasmid. therefore i need to get the sequence of the whole plasmid. my primers do not have any 5' or 3' end. the plasmid belongs to lux sequence. the primers are 1305 TACAACGATTAGTGACATATAT 1306 TCAGCAACCAGTTATCCAGCAT 1307 TAATCAACCACTTGGCAGATGT 1308 ATATTATGAGCATTAAATCTAT 1311 ATTAATAACATGATGTATCTT        |
| Today
| ||||
| ||||
 Sponsored Links |
|
06-05-2008, 03:51 PM
| ||||||
| ||||||
| Re: urgent help needed in sequencing plasmid Track down the manufacturer of the plasmid, I couldn't find lux-sequence as a company, more like a plasmid with luciferase gene. Also plasmids have specific names like pSMART, pUC, pQE, ..... You should be able to get that info from webpages and product sheets. |
|
| Tags |
| needed , plasmid , sequencing , urgent |
| Thread Tools | |
| Display Modes | |
|
|
Similar Threads | ||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| Plasmid DNA Isolation from Bacteria | domba | Molecular Biology Articles and Protocols | 1 | 08-04-2008 05:14 AM |
| Lysis for WB with Ripa Buffer - too viscous, no pellet - urgent help needed, please | Anne-Marie | Western Blot Forum | 2 | 10-29-2007 05:12 PM |
| Reuse of Plasmid with Insert from Agrobacterium cells | molbio123 | DNA Techniques | 2 | 08-05-2007 05:47 PM |
Linear Mode
