Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Proteomics Forum > Peptide Forum
Register Search Today's Posts Mark Forums Read

Peptide Forum Peptide Forum. Ask and discuss questions on peptide protocols, custom peptide synthesis, peptide identification and peptide sequencing.


How to draw all possible peptides ( amino acid sequences ) ?

How to draw all possible peptides ( amino acid sequences ) ? - Peptide Forum

How to draw all possible peptides ( amino acid sequences ) ? - Peptide Forum. Ask and discuss questions on peptide protocols, custom peptide synthesis, peptide identification and peptide sequencing.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 09-16-2012, 06:16 PM
Pipette Filler
Points: 197, Level: 3 Points: 197, Level: 3 Points: 197, Level: 3
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Oct 2008
Posts: 4
Thanks: 0
Thanked 0 Times in 0 Posts
Default How to draw all possible peptides ( amino acid sequences ) ?



I don't understand this question:
How to draw all possible peptides ( amino acid sequences ) resulting from translation of all six reading frames.

5' CGUUGUGUAUCCGUCAUUUUAAAAAUGACU

Thanks,
Reply With Quote
  #2  
Old 09-17-2012, 03:59 AM
Kunal Pandya's Avatar
Graduate Student
Points: 2,911, Level: 35 Points: 2,911, Level: 35 Points: 2,911, Level: 35
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2009
Location: India
Posts: 139
Thanks: 0
Thanked 6 Times in 6 Posts
Thumbs up Re: How to draw all possible peptides ( amino acid sequences ) ?

Hi,

For complete detail and explanation please go through the link I provided at the end of the reply.You get complete explanayion with Example.

Translation and Open Reading Frame Search

Regions of DNA that encode proteins are first transcribed into messenger RNA and then translated into protein. By examining the DNA sequence alone we can determine the sequence of amino acids that will appear in the final protein. In translation codons of three nucleotides determine which amino acid will be added next in the growing protein chain. It is important then to decide which nucleotide to start translation, and when to stop, this is called an open reading frame.

Once a gene has been sequenced it is important to determine the correct open reading frame (ORF). Every region of DNA has six possible reading frames, three in each direction. The reading frame that is used determines which amino acids will be encoded by a gene. Typically only one reading frame is used in translating a gene (in eukaryotes), and this is often the longest open reading frame. Once the open reading frame is known the DNA sequence can be translated into its corresponding amino acid sequence. An open reading frame starts with an atg (Met) in most species and ends with a stop codon (taa, tag or tga).

[Only registered users see links. ]

Regards
Kunal Pandya
__________________
Kunal Pandya
Reply With Quote
Reply

Tags
acid , amino , draw , peptides , sequences


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
How to draw the structural formula to amino acid peptide? Crowe Peptide Forum 1 12-20-2011 07:57 AM
USA - custom petides? avinash Proteomics Forum 6 06-09-2010 04:10 AM
10 mM HCl for IGF-I low.d Chemistry Forum 19 01-21-2010 11:33 PM
A carbon-13 trifluoromethyl group within an amino acid David Naugler Organic Chemistry Forum 0 08-09-2003 02:38 PM
A carbon-13 trifluoromethyl group within an amino acid David Naugler Chemistry Forum 1 08-07-2003 06:34 PM


All times are GMT. The time now is 04:00 AM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.15246 seconds with 16 queries