Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (http://www.molecularstation.com/forum/)
-   Peptide Forum (http://www.molecularstation.com/forum/peptide-forum/)
-   -   How to draw all possible peptides ( amino acid sequences ) ? (http://www.molecularstation.com/forum/peptide-forum/86446-how-draw-all-possible-peptides-amino-acid-sequences.html)

Derek 09-16-2012 06:16 PM

How to draw all possible peptides ( amino acid sequences ) ?
 
I don't understand this question:
How to draw all possible peptides ( amino acid sequences ) resulting from translation of all six reading frames.

5' CGUUGUGUAUCCGUCAUUUUAAAAAUGACU

Thanks,

Kunal Pandya 09-17-2012 03:59 AM

Re: How to draw all possible peptides ( amino acid sequences ) ?
 
Hi,

For complete detail and explanation please go through the link I provided at the end of the reply.You get complete explanayion with Example.

Translation and Open Reading Frame Search

Regions of DNA that encode proteins are first transcribed into messenger RNA and then translated into protein. By examining the DNA sequence alone we can determine the sequence of amino acids that will appear in the final protein. In translation codons of three nucleotides determine which amino acid will be added next in the growing protein chain. It is important then to decide which nucleotide to start translation, and when to stop, this is called an open reading frame.

Once a gene has been sequenced it is important to determine the correct open reading frame (ORF). Every region of DNA has six possible reading frames, three in each direction. The reading frame that is used determines which amino acids will be encoded by a gene. Typically only one reading frame is used in translating a gene (in eukaryotes), and this is often the longest open reading frame. Once the open reading frame is known the DNA sequence can be translated into its corresponding amino acid sequence. An open reading frame starts with an atg (Met) in most species and ends with a stop codon (taa, tag or tga).

[Only registered and activated users can see links. Click Here To Register...]

Regards
Kunal Pandya


All times are GMT. The time now is 04:06 AM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.12807 seconds with 11 queries