Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.

Primer dimer

Primer dimer - PCR - Polymerase Chain Reaction Forum

Primer dimer - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.

LinkBack Thread Tools Display Modes
Old 08-19-2013, 07:55 PM
Pipette Filler
Points: 58, Level: 1 Points: 58, Level: 1 Points: 58, Level: 1
Activity: 0% Activity: 0% Activity: 0%
Join Date: Aug 2013
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Unhappy Primer dimer

When doing normal PCR, I always get a strong band at the bottom of the gel ~50bp instead of the expected band ~2kb. I think I'm having a primer dimer problem. I've tried dilute the primers, boiled the primers for 5 min, and added 5% DMSO, but didn't work. My primers are attached on the 5' end by the restriction enzyme cutting site, and 6 random nt at the 5' end of the enzyme cutting site. When running my primers in the NCBI primer designing tool, my forward primer (ACTGCACTCGAGATGAGTAATGGAAATCACC) shows 8.00 at self complementarity and 2.00 at self 3' complementarity. My reverse primer (TAGTCAGAATTCAATCCTTCTGTTTCACTTGC) shows 7.00 at self complementarity and 2.00 at self 3' complementarity. BTW, I can get the expected 2kb band at the first 2-3 times using the primers when the primers newly come. When the primers come in, I first made 100mM stock and then made 10 10mM dilutions for future usage. Everything I did is doing on ice.

Anyone know what the problem is? Is there any way to fix this without redesigning primers? Thanks!!
Reply With Quote
Old 08-19-2013, 08:03 PM
Pipette Filler
Points: 58, Level: 1 Points: 58, Level: 1 Points: 58, Level: 1
Activity: 0% Activity: 0% Activity: 0%
Join Date: Aug 2013
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: Primer dimer

Sorry, the primer stock is 100uM, and dilution is 10uM.
Reply With Quote

dimer , primer , primer design , primer dimer , restriction enzyme

Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
No Amplification -- Primer Dimer saranyah PCR - Polymerase Chain Reaction Forum 19 09-26-2011 07:54 AM
primer dimer and non specific bands rair PCR - Polymerase Chain Reaction Forum 3 06-07-2011 10:41 PM
please help me in primer dimer saly Real-Time PCR and Quantitative PCR Forum 0 09-06-2008 02:18 PM
Primer Dimer PCR Problem admin PCR - Polymerase Chain Reaction Forum 0 09-01-2008 05:24 AM
primer dimer saly PCR - Polymerase Chain Reaction Forum 0 08-28-2008 01:57 PM

All times are GMT. The time now is 02:22 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2015, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.11922 seconds with 16 queries