Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (
-   PCR - Polymerase Chain Reaction Forum (
-   -   Primer dimer (

gracelee-1226 08-19-2013 07:55 PM

Primer dimer
When doing normal PCR, I always get a strong band at the bottom of the gel ~50bp instead of the expected band ~2kb. I think I'm having a primer dimer problem. I've tried dilute the primers, boiled the primers for 5 min, and added 5% DMSO, but didn't work. My primers are attached on the 5' end by the restriction enzyme cutting site, and 6 random nt at the 5' end of the enzyme cutting site. When running my primers in the NCBI primer designing tool, my forward primer (ACTGCACTCGAGATGAGTAATGGAAATCACC) shows 8.00 at self complementarity and 2.00 at self 3' complementarity. My reverse primer (TAGTCAGAATTCAATCCTTCTGTTTCACTTGC) shows 7.00 at self complementarity and 2.00 at self 3' complementarity. BTW, I can get the expected 2kb band at the first 2-3 times using the primers when the primers newly come. When the primers come in, I first made 100mM stock and then made 10 10mM dilutions for future usage. Everything I did is doing on ice.

Anyone know what the problem is? Is there any way to fix this without redesigning primers? Thanks!!

gracelee-1226 08-19-2013 08:03 PM

Re: Primer dimer
Sorry, the primer stock is 100uM, and dilution is 10uM.

All times are GMT. The time now is 02:58 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2015, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.08931 seconds with 11 queries