Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Amplification won't work!

Amplification won't work! - PCR - Polymerase Chain Reaction Forum

Amplification won't work! - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 06-08-2013, 08:14 AM
Pipette Filler
Points: 14, Level: 1 Points: 14, Level: 1 Points: 14, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jun 2013
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Default Amplification won't work!



I'm trying to amplify a ~200bp segment from a ~4kb plasmid. A postdoc in my lab previously amplified the segment and gave me a stock of gel-extracted PCR product, the starting plasmid, the primers, and the thermocycle he used (standard 95/5min - [95/30s-55/30s-72/30s]x25cycles - 72/10min).

The template plasmid he gave me is pCDFDuet-1 and the primers are
GGATCCGGGAGCAGTGCTAGCGGAACTTCTAGCACT
ACCCATATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATGGG
I'm using NEB Q5 High-Fidelity 2X Master Mix, I just thawed a brand new tube of master mix, mixed well, and keep it on ice/frozen.

I copied his reaction exactly (as far as I can tell) and got no band. I've tried reducing annealing temp, reducing primer conc, reducing template conc, with no luck. The problem is probably not those things though, I think it's the template.

I tried amplifying the segment not just from the stock of Duet plasmid he gave me, but from another plasmid he gave me, DHFR-Duet. He cloned DHFR into Duet himself. When I used that as a template, I got a super strong product band at ~560bp, which is the length of DHFR... In the same test, I made a reaction that was identical except with a different Duet vector test tube (empty plasmid -- no DHFR). That reaction gave no band as well.

0. GeneRuler 100 bp Plus DNA Ladder 100 to 3000
1. Alternate empty Duet
2. DHFR-Duet
3. DHFR-Duet
4. Original empty Duet
5. PCR amplicon as template
You can see the gel at:
sphotos-b.xx.fbcdn.net/hphotos-frc3/969933_542671315775665_22825818_n.jpg

The postdoc is very organized and this lab runs a tight ship, so it's unlikely he gave me the wrong template. Why am I getting a 500bp product from Duet-DHFR and no product from empty Duet? I should be getting a shorter product from empty Duet at least, if the primers are located on Duet. I tried blasting both primers and only one matches to Duet. Any clues on where these primers match to on either Duet or DHFR? Or other reasons it won't freakin amplify from the template he gave me?

This is my first week as the new grad student in this lab and I really want to make this reaction work...!
Reply With Quote
Reply

Tags
amplification , work


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Any ideas why my PCR amplification won't work? math PCR - Polymerase Chain Reaction Forum 0 06-08-2013 07:56 AM
Question about work and friction Robert Physics Forum 2 01-04-2008 12:50 PM
Politics And Cannibalism? Introducing The Dourties, Chelsea, Bill, Hillary, Barrack Obama, George Bush, Jr., And All Of Capital Hill! jon_johnfrancisayres@yahoo.com Microbiology Forum 0 10-06-2007 05:59 AM
Flaws in Current Atomic Theory? cinquirer Physics Forum 42 11-25-2003 07:58 PM


All times are GMT. The time now is 02:26 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.13547 seconds with 16 queries