Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (http://www.molecularstation.com/forum/)
-   PCR - Polymerase Chain Reaction Forum (http://www.molecularstation.com/forum/pcr-polymerase-chain-reaction-forum/)
-   -   Amplification won't work! (http://www.molecularstation.com/forum/pcr-polymerase-chain-reaction-forum/87923-amplification-wont-work.html)

math 06-08-2013 08:14 AM

Amplification won't work!
 
I'm trying to amplify a ~200bp segment from a ~4kb plasmid. A postdoc in my lab previously amplified the segment and gave me a stock of gel-extracted PCR product, the starting plasmid, the primers, and the thermocycle he used (standard 95/5min - [95/30s-55/30s-72/30s]x25cycles - 72/10min).

The template plasmid he gave me is pCDFDuet-1 and the primers are
GGATCCGGGAGCAGTGCTAGCGGAACTTCTAGCACT
ACCCATATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATGGG
I'm using NEB Q5 High-Fidelity 2X Master Mix, I just thawed a brand new tube of master mix, mixed well, and keep it on ice/frozen.

I copied his reaction exactly (as far as I can tell) and got no band. I've tried reducing annealing temp, reducing primer conc, reducing template conc, with no luck. The problem is probably not those things though, I think it's the template.

I tried amplifying the segment not just from the stock of Duet plasmid he gave me, but from another plasmid he gave me, DHFR-Duet. He cloned DHFR into Duet himself. When I used that as a template, I got a super strong product band at ~560bp, which is the length of DHFR... In the same test, I made a reaction that was identical except with a different Duet vector test tube (empty plasmid -- no DHFR). That reaction gave no band as well.

0. GeneRuler 100 bp Plus DNA Ladder 100 to 3000
1. Alternate empty Duet
2. DHFR-Duet
3. DHFR-Duet
4. Original empty Duet
5. PCR amplicon as template
You can see the gel at:
sphotos-b.xx.fbcdn.net/hphotos-frc3/969933_542671315775665_22825818_n.jpg

The postdoc is very organized and this lab runs a tight ship, so it's unlikely he gave me the wrong template. Why am I getting a 500bp product from Duet-DHFR and no product from empty Duet? I should be getting a shorter product from empty Duet at least, if the primers are located on Duet. I tried blasting both primers and only one matches to Duet. Any clues on where these primers match to on either Duet or DHFR? Or other reasons it won't freakin amplify from the template he gave me?

This is my first week as the new grad student in this lab and I really want to make this reaction work...!


All times are GMT. The time now is 02:42 AM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.08884 seconds with 11 queries