Troblshooting Conventional PCR

[alizohaib7]

Hi fellows
I want to amplify SARM gene CDS portion almost of 2200bp.

1st I isolated RNA by using Trizol reagent and then I made cDNA by using Tobyo kit.

My target sequence is

atggtcctgacgctgcttctctccgcctacaagctgtgtcgcttcttcgc catgtcgggcccacggccgggcgccgagcggctggcggtgcctgggccag atgggggcggtggcacgggcccatggtgggctgcgggtggccgcgggccc cgcgaagtgtcgccgggggcaggcaccgaggtgcaggacgccctggagcg cgcgctgccggagctgcagcaggccttgtccgcgctgaagcaggcgggcg gcgcgcgggccgtgggcgccggcctggccgaggtcttccaactggtggag gaggcctggctgctgccggccgtgggccgcgaggtagcccagggtctgtg cgacgccatccgcctcgatggcggcctcgacctgctgttgcggctgctgc aggcgccggagttggagacgcgtgtgcaggccgcgcgcctgctggagcag atcctggtggctgagaaccgagaccgcgtggcgcgcattgggctgggcgt gatcctgaacctggcgaaggaacgcgaacccgtagagctggcgcggagcg tggcaggcatcttggagcacatgttcaagcattcggaggagacatgccag aggctggtggcggccggcggcctggacgcggtgctgtattggtgccgccg cacggaccccgcgctgctgcgccactgcgcgctggcgctgggcaactgcg cgctgcacgggggccaggcggtgcagcgacgcatggtagagaagcgcgca gccgagtggctcttcccgctcgccttctccaaggaggacgagctgcttcg gctgcacgcctgcctcgcagtagcggtgttggcgactaacaaggaggtgg agcgcgaggtggagcgctcgggcacgctggcgctcgtggagccgcttgtg gcctcgctggaccctggccgcttcgcccgctgtctggtggacgccagcga cacaagccagggccgcgggcccgacgacctgcagcgcctcgtgccgttgc tcgactctaaccgcttggaggcgcagtgcatcggggctttctacctctgc gccgaggctgccatcaagagcctgcaaggcaagaccaaggtgttcagcga catcggcgccatccagagcctgaaacgcctggtttcctactctaccaatg gcactaagtcggcgctggccaagcgcgcgctgcgcctgctgggcgaggag gtgccacggcccatcctgccctccgtgcccagctggaaggaggccgaggt tcagacgtggctgcagcagatcggtttctccaagtactgcgagagcttcc gggagcagcaggtggatggcgacctgcttctgcggctcacggaggaggaa ctccagaccgacctgggcatgaaatcgggcatcacccgcaagaggttctt tagggagctcacggagctcaagaccttcgccaactattctacgtgcgacc gcagcaacctggcggactggctgggcagcctggacccgcgcttccgccag tacacctacggcctggtcagctgcggcctggaccgctccctgctgcaccg cgtgtctgagcagcagctgctggaagactgcggcatccacctgggcgtgc accgcgcccgcatcctcacggcggccagagaaatgctacactccccgctg ccctgtactggtggcaaacccagtggggacactccagatgtcttcatcag ctaccgccggaactcaggttcccagctggccagtctcctgaaggtgcacc tgcagctgcatggcttcagtgtcttcattgatgtggagaagctggaagca ggcaagttcgaggacaaactcatccagagtgtcatgggtgcccgcaactt tgtgttggtgctatcacctggagcactggacaagtgcatgcaagaccatg actgcaaggattgggtgcataaggagattgtgactgctttaagctgcggc aagaacattgtgcccatcattgatggcttcgagtggcctgagccccaggt cctgcctgaggacatgcaggctgtgcttactttcaacggtatcaagtggt cccacgaataccaggaggccaccattgagaagatcatccgcttcctgcag ggccgctcctcccgggactcatctgcaggctctgacaccagtttggaggg tgctgcacccatgggtccaacctaa


Forward Primer

CAGATCT atg gtc ctg acg ctg ctt ctc tcc


Reverse Primer

GGGTACC tta ggt tgg acc cat ggg tgc agc

Red portion in primer sequences are the additional Restriction Enzymes sites
which I need for my expression vector.


I have tried following thermocycling conditions


95 C for 5 min

95 C for 1 min

51 or 53 or 55 or 57 for 1min

72 for 2 min

and 72 for 5 min
for total of 35 Cycles..


But I did not find anything after runing gel.


Can anyone please help me in this

[butters]

A quick one,
for 2200bp you would probably require 2.5 minutes for extension.

check your taq spec generally is 1kb per minutes. For long PCR amplicon sometimes you may need some modification with your taq (combination of normal taq with pfu taq). Just try the 2.5 minutes first with probably slightly more CaCl2. But hey i could be wrong.

Update when you have tried that.

[luisillo]

I've never worked with fragments that long, but what butters says about the extension time sounds like a good thing to start adjusting. I can advice something about the annealing temp, though.

You should use annealing temps between 55-60ºC at the beginning, or even better: find the Tm of your primers and start from there (i.e. if the tm is 57ºC for F and 60ºC for R you can try 57, 58, 59 and 60 ºC temp gradient). You can search the formula for Tm on internet or try using Primer 3 of such softwares.

Good luck

[alizohaib7]

Hi
I tried with premix with following conditions

95 C for 5 min

95 C for 1 min

54 or 56 or 58 or 60 for 1.5min

72 for 2.5 min

and 72 for 5 min
for total of 30 Cycles..

but find nothing again

[luisillo]

Do you have a positive control in this test? I mean a sample that you know it has to amplify (any DNA that contains your sequence of interest). I tell you this because the problem might be in yor template (cDNA). Try quatifying your cDNA in a spectrophotomer to check out the quantity and quality of it. Also you can run an agarose gel (0.8%) loading your cDNA samples to it.

Be patient, not all PCRs work at the first try.

Again, good luck.

[alizohaib7]

I will check this with agrose gel cDNA ok
Thanks for your helping hand
hats off