Good melting curve but non-specific products appeared

[sengwu_21]

Dear all,

I am a newbie in running qPCR and I am encountering some problems, especially after running qPCR can get a nice melt curve but more than one band appeared on 1.5% agarose gel (120V for 45min).

I designed the primer sets (Tm = 60oC) for the gene called p47phox with specific PCR product size of 194bp using Primer 3 Plus software. The sequence of forward and reverse primers is as below:

Forward primer - AGTCCTGACGAGACGGAAGA (length = 20)
Reverse primer - TACATGGACGGGAAGTAGCC (length = 20)

So far, I optimized using three annealing temperatures of 50, 53, and 55. Among them, 53 give a good peak without any smaller peaks, or etc.

FYI, I used 5x HOT FirePOl Evagreen qPCR Mix Plus (ROX) from Solis BioDyne. The mix composed of HOT FifrePol DNA polymerase, 5x Evagreen qPCR buffer, 12.5mM MgCl2 (1x PCR solution = 2.5mM), dNTPS, Evagreen dye and ROX dye. Following are the final concentrations of Evagreen master mix, primer sets, DNA template per 20ul PCR tube (one reaction):

5x HOT FirePol Evegreen qPCR Mix Plus - 4ul (1x)
Primer forward - 0.5ul (250nM)
Primer reverse - 0.5ul (250nM)
DNA template - 1ul (2.5ng/ul)
H2O PCR grade - 14ul

Following is the qPCR cycles:
Initial denaturation - 95oC, 15min, 1 cycle
Denaturation - 95oC, 15s, 40 cycles
Annealing - 50, 53 or 55, 20s 40 cycles
Elongation - 72oC, 20s

Here attached the melt curves for annealing temperatures of 53 (Lane 4) and 55 (Lane 6) as well as the result of gel electrophoresis.

Lane1: DNA marker
Lane 2 & 3: 50oC annealing temperature with 1ul and 2ul cDNA template, respectively.
Lane 4: 53oC annealing temperature
Lane 5 & 6: 55oC annealing temperature with two different cDNA template (different date of
preparation)




My questions as below:

1) How to clear the non-specific product or dimer-primer based on my qPCR condition or master mix, if relevant?
2) How come there are many bands appeared even though there is a nice melt curve obtained with annealing temperature of 53?
3) Why specific product shows different Tm with different annealing temperatures (please refer to the attachment)?
4) Since there is Evagreen dye included master mix, do I still need to place dye for gel electrophoresis? For this case, I am using gel red\
dye.

Hopefully, you guys could share the great experiences and knowledges with me.

Many thanks

Seng

[Jenniferayt]

ÿþ[

ÿþ[

ÿþ[