Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.

Good melting curve but non-specific products appeared

Good melting curve but non-specific products appeared - PCR - Polymerase Chain Reaction Forum

Good melting curve but non-specific products appeared - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.

LinkBack Thread Tools Display Modes
Old 09-20-2012, 11:58 AM
Pipette Filler
Points: 59, Level: 1 Points: 59, Level: 1 Points: 59, Level: 1
Activity: 0% Activity: 0% Activity: 0%
Join Date: Sep 2012
Location: Kuala Lumpur
Posts: 1
Thanks: 0
Thanked 0 Times in 0 Posts
Default Good melting curve but non-specific products appeared

Dear all,

I am a newbie in running qPCR and I am encountering some problems, especially after running qPCR can get a nice melt curve but more than one band appeared on 1.5% agarose gel (120V for 45min).

I designed the primer sets (Tm = 60oC) for the gene called p47phox with specific PCR product size of 194bp using Primer 3 Plus software. The sequence of forward and reverse primers is as below:

Forward primer - AGTCCTGACGAGACGGAAGA (length = 20)
Reverse primer - TACATGGACGGGAAGTAGCC (length = 20)

So far, I optimized using three annealing temperatures of 50, 53, and 55. Among them, 53 give a good peak without any smaller peaks, or etc.

FYI, I used 5x HOT FirePOl Evagreen qPCR Mix Plus (ROX) from Solis BioDyne. The mix composed of HOT FifrePol DNA polymerase, 5x Evagreen qPCR buffer, 12.5mM MgCl2 (1x PCR solution = 2.5mM), dNTPS, Evagreen dye and ROX dye. Following are the final concentrations of Evagreen master mix, primer sets, DNA template per 20ul PCR tube (one reaction):

5x HOT FirePol Evegreen qPCR Mix Plus - 4ul (1x)
Primer forward - 0.5ul (250nM)
Primer reverse - 0.5ul (250nM)
DNA template - 1ul (2.5ng/ul)
H2O PCR grade - 14ul

Following is the qPCR cycles:
Initial denaturation - 95oC, 15min, 1 cycle
Denaturation - 95oC, 15s, 40 cycles
Annealing - 50, 53 or 55, 20s 40 cycles
Elongation - 72oC, 20s

Here attached the melt curves for annealing temperatures of 53 (Lane 4) and 55 (Lane 6) as well as the result of gel electrophoresis.

Lane1: DNA marker
Lane 2 & 3: 50oC annealing temperature with 1ul and 2ul cDNA template, respectively.
Lane 4: 53oC annealing temperature
Lane 5 & 6: 55oC annealing temperature with two different cDNA template (different date of

My questions as below:

1) How to clear the non-specific product or dimer-primer based on my qPCR condition or master mix, if relevant?
2) How come there are many bands appeared even though there is a nice melt curve obtained with annealing temperature of 53?
3) Why specific product shows different Tm with different annealing temperatures (please refer to the attachment)?
4) Since there is Evagreen dye included master mix, do I still need to place dye for gel electrophoresis? For this case, I am using gel red\

Hopefully, you guys could share the great experiences and knowledges with me.

Many thanks

Attached Images
File Type: jpg Melt Curve Ta of 53.jpg (68.8 KB, 1 views)
File Type: jpg Melt Curve - Ta of 55oC.jpg (64.5 KB, 1 views)
File Type: jpg 20th September 2012 - p47 50 53 55 - Copy.jpg (39.9 KB, 1 views)
Reply With Quote
Old 01-11-2013, 08:21 PM
Graduate Student
Points: 247, Level: 4 Points: 247, Level: 4 Points: 247, Level: 4
Activity: 0% Activity: 0% Activity: 0%
Join Date: Jan 2013
Posts: 100
Thanks: 0
Thanked 0 Times in 0 Posts
Default バーバリー 激安



Reply With Quote

appeared , curve , gel electrophoresis , good , melt curve , melting , non-specific product , nonspecific , products , qpcr

Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
performance of melting curve based on qPCR products namishu95 Real-Time PCR and Quantitative PCR Forum 2 04-09-2010 09:39 PM
Politics And Cannibalism? Introducing The Dourties, Chelsea, Bill, Hillary, Barrack Obama, George Bush, Jr., And All Of Capital Hill! jon_johnfrancisayres@yahoo.com Microbiology Forum 0 10-06-2007 05:59 AM

All times are GMT. The time now is 10:43 AM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.14056 seconds with 17 queries