Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


long GC sequence in primer for RealTime PCR

long GC sequence in primer for RealTime PCR - PCR - Polymerase Chain Reaction Forum

long GC sequence in primer for RealTime PCR - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 07-03-2012, 03:08 PM
Pipette Filler
Points: 210, Level: 4 Points: 210, Level: 4 Points: 210, Level: 4
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jul 2012
Posts: 5
Thanks: 0
Thanked 0 Times in 0 Posts
Default long GC sequence in primer for RealTime PCR



Hi, everybody.
I am designing primers for RealTime PCR and someone in the lab told me I have to avoid long G o C in the sequence.
For example in the following primer:
5'- CCCAAGCACCGGCAGACAAG -3'
And note that the region marked it contains 5 Gs or Cs followed and I do not think this was a problem because I have checked all secondary structures with a software and it works excellent...
Is there anyone that can give me an advice?Is this true?Is ok that primer?
It will be really great!
Reply With Quote
  #2  
Old 07-05-2012, 11:22 AM
Pipette Filler
Points: 1,961, Level: 27 Points: 1,961, Level: 27 Points: 1,961, Level: 27
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jan 2010
Location: Norway
Posts: 22
Thanks: 0
Thanked 4 Times in 4 Posts
Default Re: long GC sequence in primer for RealTime PCR

The general rules for designing primer say that you should avoid long G/C stretches. But we have some primers with more than 4 G/C in a row, just because we didn't have a choice. We have tested the primers by running a standardcurve and checking the slope to see what the effectivity of the PCR-reaction is and we have tested them to check that we don't have unspesific amplification.
I think it's ok to use such primers in the cases where you don't have a choice, if you take the time to check that they are working properly.
Reply With Quote
Reply

Tags
long , pcr , primer , realtime , sequence


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Human Cytome Project - Update 24 Jan. 2005 Peter Van Osta Cell Biology and Cell Culture 1 08-01-2010 02:18 PM
Human Cytome Project - an idea - Update 19 April 2005 Peter Van Osta Cell Biology and Cell Culture 1 06-01-2009 02:17 PM
A Human Cytome Project - an idea - Update 14 March 2005 Peter Van Osta Cell Biology and Cell Culture 0 03-14-2005 01:27 PM
Human Cytome Project - Update 6 Jan. 2005 Peter Van Osta Cell Biology and Cell Culture 0 01-06-2005 10:18 AM


All times are GMT. The time now is 04:38 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.20200 seconds with 16 queries