long GC sequence in primer for RealTime PCR

[germagno86]

Hi, everybody.
I am designing primers for RealTime PCR and someone in the lab told me I have to avoid long G o C in the sequence.
For example in the following primer:
5'- CCCAAGCACCGGCAGACAAG -3'
And note that the region marked it contains 5 Gs or Cs followed and I do not think this was a problem because I have checked all secondary structures with a software and it works excellent...
Is there anyone that can give me an advice?Is this true?Is ok that primer?
It will be really great!

[Aurora Borealis]

The general rules for designing primer say that you should avoid long G/C stretches. But we have some primers with more than 4 G/C in a row, just because we didn't have a choice. We have tested the primers by running a standardcurve and checking the slope to see what the effectivity of the PCR-reaction is and we have tested them to check that we don't have unspesific amplification.
I think it's ok to use such primers in the cases where you don't have a choice, if you take the time to check that they are working properly.