Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (http://www.molecularstation.com/forum/)
-   PCR - Polymerase Chain Reaction Forum (http://www.molecularstation.com/forum/pcr-polymerase-chain-reaction-forum/)
-   -   long GC sequence in primer for RealTime PCR (http://www.molecularstation.com/forum/pcr-polymerase-chain-reaction-forum/86001-long-gc-sequence-primer-realtime-pcr.html)

germagno86 07-03-2012 03:08 PM

long GC sequence in primer for RealTime PCR
 
Hi, everybody.
I am designing primers for RealTime PCR and someone in the lab told me I have to avoid long G o C in the sequence.
For example in the following primer:
5'- CCCAAGCACCGGCAGACAAG -3'
And note that the region marked it contains 5 Gs or Cs followed and I do not think this was a problem because I have checked all secondary structures with a software and it works excellent...
Is there anyone that can give me an advice?Is this true?Is ok that primer?
It will be really great!

Aurora Borealis 07-05-2012 11:22 AM

Re: long GC sequence in primer for RealTime PCR
 
The general rules for designing primer say that you should avoid long G/C stretches. But we have some primers with more than 4 G/C in a row, just because we didn't have a choice. We have tested the primers by running a standardcurve and checking the slope to see what the effectivity of the PCR-reaction is and we have tested them to check that we don't have unspesific amplification.
I think it's ok to use such primers in the cases where you don't have a choice, if you take the time to check that they are working properly.


All times are GMT. The time now is 12:02 AM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.13190 seconds with 11 queries