Designing primers with recognition sites of restriction enzymes

[saranyah]

I'm jammed with designing a primer which should include recognition sites of restriction enzymes and ribosome binding site... The primer grows longer and it self complements... Guide me pleaseeeeeeee

[butters]

if you don't mind, do include your sequence for the primer and what restriction enzymes and the ribosome binding site. maybe some of us here have tips

[saranyah]

My primer sequence is:

Forward 5'ccgggatcccgcgcgaggatgagttatactgtcggtac3'

Reverse 5' cccggtaccctagaggagcttgttaacaggc 3'

Red: Denotes extra nucleotides to read ATG as a codon
Green: Ribosome binding site
Orange: Restriction recognition site
Black: Primer sequence

[obama]

if you don't have choice to change this sequence then you can control the experiment by adjusting pcr condition rather than the primer itself.

And when you designing primer for cloning purpose no need strict too much to the primer designing rules

[saranyah]

What parameters should I change exactly sir? Please make me clear... Should I change the PCR cycle too?

[butters]

Delta G -24.12 kcal/mole
Base Pairs 10
5' CCGGGATCCCGCGCGAGGATGAGTTATACTGTCGGTAC
||||||||||
3' CATGGCTGTCATATTGAGTAGGAGCGCGCCCTAGGGCC

Delta G -11.44 kcal/mole
Base Pairs 8
5' CCCGGTACCCTAGAGGAGCTTGTTAACAGGC
:: |||||||| ::
3' CGGACAATTGTTCGAGGAGATCCCATGGCCC

Can you don't use so many G or C as filler to correct reading frame? As long as the melting temperature is not too far apart for both primer and no hairpin or secondary structure should be good. I require some information before I can help further... cheers.

[butters]

[Only registered users see links. ]
use above online thingy to check your primer you get something in the bottom

Delta G -24.12 kcal/mole
Base Pairs 10
5'CCCGGGATCCCGCGCGAGGATGAGTTATACTGTCGGTAC
||||||||||
3' CATGGCTGTCATATTGAGTAGGAGCGCGCCCTAGGGCC

Delta G -11.44 kcal/mole
Base Pairs 8
5' CCCGGTACCCTAGAGGAGCTTGTTAACAGGC
:: |||||||| ::
3' CGGACAATTGTTCGAGGAGATCCCATGGCCC

Delta G is a wee bit too negative. Can you don't use so many G or C as filler to correct reading frame? Try to use mixture of A or G, T or C combination. As long as the melting temperature is not too far apart for both primer and no hairpin or secondary structure should be good. I require some information before I can help further... cheers.

[saranyah]

I can understand the fact you have explained. Is there by anyway I can make use of the same primer? Coz the primer synthesis is not so much affordable for me..

[butters]

Saranyah, do you mean after you use the primer is there any uses for it elsewhere or you have synthesize the primer and now in process of optimization?

[saranyah]

I'm having the synthesized primers.... and now having trouble in PCR... I can find only a primer dimer.....