Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Designing primers with recognition sites of restriction enzymes

Designing primers with recognition sites of restriction enzymes - PCR - Polymerase Chain Reaction Forum

Designing primers with recognition sites of restriction enzymes - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 12-26-2011, 08:45 AM
saranyah's Avatar
Volunteer
Points: 1,194, Level: 19 Points: 1,194, Level: 19 Points: 1,194, Level: 19
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 30
Thanks: 0
Thanked 2 Times in 2 Posts
Angry Designing primers with recognition sites of restriction enzymes



I'm jammed with designing a primer which should include recognition sites of restriction enzymes and ribosome binding site... The primer grows longer and it self complements... Guide me pleaseeeeeeee
Reply With Quote
  #2  
Old 12-26-2011, 11:50 PM
butters's Avatar
Post-Doc
Points: 4,013, Level: 42 Points: 4,013, Level: 42 Points: 4,013, Level: 42
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2008
Location: Malaysia
Posts: 293
Thanks: 23
Thanked 67 Times in 62 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

if you don't mind, do include your sequence for the primer and what restriction enzymes and the ribosome binding site. maybe some of us here have tips
Reply With Quote
  #3  
Old 12-28-2011, 02:38 AM
saranyah's Avatar
Volunteer
Points: 1,194, Level: 19 Points: 1,194, Level: 19 Points: 1,194, Level: 19
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 30
Thanks: 0
Thanked 2 Times in 2 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

My primer sequence is:

Forward 5'ccgggatcccgcgcgaggatgagttatactgtcggtac3'

Reverse 5' cccggtaccctagaggagcttgttaacaggc 3'

Red: Denotes extra nucleotides to read ATG as a codon
Green: Ribosome binding site
Orange: Restriction recognition site
Black: Primer sequence
Reply With Quote
  #4  
Old 12-28-2011, 08:16 AM
obama's Avatar
Graduate Student
Points: 2,830, Level: 34 Points: 2,830, Level: 34 Points: 2,830, Level: 34
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jan 2009
Location: Hannover Germany
Posts: 145
Thanks: 2
Thanked 25 Times in 21 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

if you don't have choice to change this sequence then you can control the experiment by adjusting pcr condition rather than the primer itself.

And when you designing primer for cloning purpose no need strict too much to the primer designing rules
Reply With Quote
  #5  
Old 12-29-2011, 03:45 AM
saranyah's Avatar
Volunteer
Points: 1,194, Level: 19 Points: 1,194, Level: 19 Points: 1,194, Level: 19
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 30
Thanks: 0
Thanked 2 Times in 2 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

What parameters should I change exactly sir? Please make me clear... Should I change the PCR cycle too?
Reply With Quote
  #6  
Old 12-29-2011, 06:34 AM
butters's Avatar
Post-Doc
Points: 4,013, Level: 42 Points: 4,013, Level: 42 Points: 4,013, Level: 42
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2008
Location: Malaysia
Posts: 293
Thanks: 23
Thanked 67 Times in 62 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

Delta G -24.12 kcal/mole
Base Pairs 10
5' CCGGGATCCCGCGCGAGGATGAGTTATACTGTCGGTAC
||||||||||
3' CATGGCTGTCATATTGAGTAGGAGCGCGCCCTAGGGCC

Delta G -11.44 kcal/mole
Base Pairs 8
5' CCCGGTACCCTAGAGGAGCTTGTTAACAGGC
:: |||||||| ::
3' CGGACAATTGTTCGAGGAGATCCCATGGCCC

Can you don't use so many G or C as filler to correct reading frame? As long as the melting temperature is not too far apart for both primer and no hairpin or secondary structure should be good. I require some information before I can help further... cheers.
Reply With Quote
  #7  
Old 12-29-2011, 06:40 AM
butters's Avatar
Post-Doc
Points: 4,013, Level: 42 Points: 4,013, Level: 42 Points: 4,013, Level: 42
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2008
Location: Malaysia
Posts: 293
Thanks: 23
Thanked 67 Times in 62 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

[Only registered users see links. ]
use above online thingy to check your primer you get something in the bottom

Delta G -24.12 kcal/mole
Base Pairs 10
5'CCCGGGATCCCGCGCGAGGATGAGTTATACTGTCGGTAC
||||||||||
3' CATGGCTGTCATATTGAGTAGGAGCGCGCCCTAGGGCC

Delta G -11.44 kcal/mole
Base Pairs 8
5' CCCGGTACCCTAGAGGAGCTTGTTAACAGGC
:: |||||||| ::
3' CGGACAATTGTTCGAGGAGATCCCATGGCCC

Delta G is a wee bit too negative. Can you don't use so many G or C as filler to correct reading frame? Try to use mixture of A or G, T or C combination. As long as the melting temperature is not too far apart for both primer and no hairpin or secondary structure should be good. I require some information before I can help further... cheers.
Reply With Quote
  #8  
Old 12-29-2011, 07:59 AM
saranyah's Avatar
Volunteer
Points: 1,194, Level: 19 Points: 1,194, Level: 19 Points: 1,194, Level: 19
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 30
Thanks: 0
Thanked 2 Times in 2 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

I can understand the fact you have explained. Is there by anyway I can make use of the same primer? Coz the primer synthesis is not so much affordable for me..
Reply With Quote
  #9  
Old 12-29-2011, 09:26 AM
butters's Avatar
Post-Doc
Points: 4,013, Level: 42 Points: 4,013, Level: 42 Points: 4,013, Level: 42
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2008
Location: Malaysia
Posts: 293
Thanks: 23
Thanked 67 Times in 62 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

Saranyah, do you mean after you use the primer is there any uses for it elsewhere or you have synthesize the primer and now in process of optimization?
Reply With Quote
  #10  
Old 12-31-2011, 01:42 AM
saranyah's Avatar
Volunteer
Points: 1,194, Level: 19 Points: 1,194, Level: 19 Points: 1,194, Level: 19
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 30
Thanks: 0
Thanked 2 Times in 2 Posts
Default Re: Designing primers with recognition sites of restriction enzymes

I'm having the synthesized primers.... and now having trouble in PCR... I can find only a primer dimer.....
Reply With Quote
Reply

Tags
designing , enzymes , primers , recognition , restriction , sites


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Help with restriction enzymes!! grandhotel Biochemistry Forum 0 03-26-2011 12:23 PM
Help with Restriction enzymes!! grandhotel DNA Forum 0 03-26-2011 12:21 PM
Original Biotech Rap Restriction Enzymes Funny Video dnamolecule Science and Lab Jokes 0 11-29-2007 03:39 AM
Restriction sites. Ezhil Subbian Protocols and Methods Forum 1 06-29-2006 02:43 AM
Introduction of restriction sites via extended primers? Peter Frank Protocols and Methods Forum 6 08-14-2004 06:34 AM


All times are GMT. The time now is 06:07 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.20147 seconds with 16 queries