Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (
-   PCR - Polymerase Chain Reaction Forum (
-   -   Designing primers with recognition sites of restriction enzymes (

saranyah 12-26-2011 09:45 AM

Designing primers with recognition sites of restriction enzymes
I'm jammed with designing a primer which should include recognition sites of restriction enzymes and ribosome binding site... The primer grows longer and it self complements... Guide me pleaseeeeeeee

butters 12-27-2011 12:50 AM

Re: Designing primers with recognition sites of restriction enzymes
if you don't mind, do include your sequence for the primer and what restriction enzymes and the ribosome binding site. maybe some of us here have tips :D

saranyah 12-28-2011 03:38 AM

Re: Designing primers with recognition sites of restriction enzymes
My primer sequence is:

Forward 5'ccgggatcccgcgcgaggatgagttatactgtcggtac3'

Reverse 5' cccggtaccctagaggagcttgttaacaggc 3'

Red: Denotes extra nucleotides to read ATG as a codon
Green: Ribosome binding site
Orange: Restriction recognition site
Black: Primer sequence

obama 12-28-2011 09:16 AM

Re: Designing primers with recognition sites of restriction enzymes
if you don't have choice to change this sequence then you can control the experiment by adjusting pcr condition rather than the primer itself.

And when you designing primer for cloning purpose no need strict too much to the primer designing rules

saranyah 12-29-2011 04:45 AM

Re: Designing primers with recognition sites of restriction enzymes
What parameters should I change exactly sir? Please make me clear... Should I change the PCR cycle too?

butters 12-29-2011 07:34 AM

Re: Designing primers with recognition sites of restriction enzymes
Delta G -24.12 kcal/mole
Base Pairs 10

Delta G -11.44 kcal/mole
Base Pairs 8
:: |||||||| ::

Can you don't use so many G or C as filler to correct reading frame? As long as the melting temperature is not too far apart for both primer and no hairpin or secondary structure should be good. I require some information before I can help further... cheers. :D

butters 12-29-2011 07:40 AM

Re: Designing primers with recognition sites of restriction enzymes
[Only registered and activated users can see links. Click Here To Register...]
use above online thingy to check your primer you get something in the bottom

Delta G -24.12 kcal/mole
Base Pairs 10

Delta G -11.44 kcal/mole
Base Pairs 8
:: |||||||| ::

Delta G is a wee bit too negative. Can you don't use so many G or C as filler to correct reading frame? Try to use mixture of A or G, T or C combination. As long as the melting temperature is not too far apart for both primer and no hairpin or secondary structure should be good. I require some information before I can help further... cheers. :D

saranyah 12-29-2011 08:59 AM

Re: Designing primers with recognition sites of restriction enzymes
I can understand the fact you have explained. Is there by anyway I can make use of the same primer? Coz the primer synthesis is not so much affordable for me.. :sad_cry:

butters 12-29-2011 10:26 AM

Re: Designing primers with recognition sites of restriction enzymes
Saranyah, do you mean after you use the primer is there any uses for it elsewhere or you have synthesize the primer and now in process of optimization?

saranyah 12-31-2011 02:42 AM

Re: Designing primers with recognition sites of restriction enzymes
I'm having the synthesized primers.... and now having trouble in PCR... I can find only a primer dimer.....

All times are GMT. The time now is 02:23 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2015, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.09784 seconds with 11 queries