Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Help in optimising PCR

Help in optimising PCR - PCR - Polymerase Chain Reaction Forum

Help in optimising PCR - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 09-20-2011, 07:00 AM
Pipette Filler
Points: 427, Level: 8 Points: 427, Level: 8 Points: 427, Level: 8
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 8
Thanks: 1
Thanked 3 Times in 3 Posts
Unhappy Help in optimising PCR



Hello,

I am a really worried student who is trying to get back the amplification products which at one time were very good. I am in the process of optimizing a Nested PCR for my organism.The primers are as follows:

For the first cycle:

F primer: TCAAGCTTATTGCTAGTGCAATGTCTGC.
R primer: AGGGATCCCTGCTGCTGTGCTTGCTGCG

For the second nested cycle:

F primer: GATCAAGCTTCCTCAGCCTACTATAATGCC
R primer: CTAGGGATCCCGACAGAGCACTATTAGGC

The cycling conditions used for both the first and second cycles is

94o C – 5 mins
94o C – 30 secs for 35 cycles
57o C – 2 mins
70o C – 2 mins
70o C – 10 mins extension
The expected product size is 1003 bp in the first cycle and 483 bp in the second .I have used the reagents in the following concentration:

Water: 13.2μl, MgCl2 : 0.6 μl, Buffer :2 μl , dNTP:0.8 μl , F primer: 0.4μl , R primer0.4 μl , DNA:2 μl, Enzyme:0.6 (Taq polymerase II) μl (Total volume: 25 μl )

I used to get very good bands from clinical samples but suddenly one day everything was smears, Initially I thought it could be a problem with one of the reagents though I could’nt find which one. After replacing the reagents and the primers and repeat extraction of DNA I am getting primer dimers with the same positive sample. I have doubts as to the annealing temperature and the extension time of the enzyme.Since I have tried so many alternatives I am at a loss for ideas. Does PCR need optimization with every batch of new reagents? What could be the possible reason of this sudden reaction? Please help!!!
Reply With Quote
  #2  
Old 09-20-2011, 08:18 AM
admin's Avatar
Administrator
 
Join Date: Nov 2005
Posts: 1,418
Thanks: 883
Thanked 68 Times in 58 Posts
Default Re: Help in optimising PCR

How have you been storing the source (template) DNA samples? Have they been stored well (moved?/thawed out)?
Reply With Quote
  #3  
Old 09-21-2011, 04:30 PM
Pipette Filler
Points: 427, Level: 8 Points: 427, Level: 8 Points: 427, Level: 8
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 8
Thanks: 1
Thanked 3 Times in 3 Posts
Default Re: Help in optimising PCR

Hello,
I have been storing the DNA. I thought that it could be degraded and tried repeating with fresh extracted DNA , still the primer dimer persists.

Thank You !!!
Reply With Quote
  #4  
Old 09-26-2011, 09:23 AM
Graduate Student
Points: 3,129, Level: 36 Points: 3,129, Level: 36 Points: 3,129, Level: 36
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2008
Posts: 108
Thanks: 4
Thanked 48 Times in 42 Posts
Default Re: Help in optimising PCR

It's one of the mysteries in life.

Start fresh.

1. Extract new DNA.
2. Use entirely new batch of reagents: from taq to primers etc. Even water.
3. Do not use the exact cycling parameters. Run a gradient for the annealing temperature.

My opinion is that once something goes wrong and you can't seem to find what it is, just give up after a while. Start completely from fresh, and discard all previous assumptions you have on the previously successful amplifications. That includes the cycling parameters and the reaction setup.
Reply With Quote
The Following User Says Thank You to jonoave For This Useful Post:
Nita Rajakumar (09-28-2011)
  #5  
Old 09-27-2011, 04:58 AM
Pipette Filler
Points: 427, Level: 8 Points: 427, Level: 8 Points: 427, Level: 8
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 8
Thanks: 1
Thanked 3 Times in 3 Posts
Default Re: Help in optimising PCR

Thanks Jonoave,
Will try out your suggestions.

Nita
Reply With Quote
  #6  
Old 09-29-2011, 10:34 AM
butters's Avatar
M.D/Ph.D
Points: 4,938, Level: 47 Points: 4,938, Level: 47 Points: 4,938, Level: 47
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2008
Location: Malaysia
Posts: 315
Thanks: 25
Thanked 68 Times in 63 Posts
Default Re: Help in optimising PCR

what have you change before it work?
PCR machine? Check that nobody play with your protocol or run same protocol on another machine.
Did you just started with a new batch of reagent? Taq? dNTP?
Did you did dilution of your 1st round PCR?

my your Taq is 5U/uL or 1U/uL? 0.6uL seem to be higher than normal...
Reply With Quote
The Following User Says Thank You to butters For This Useful Post:
admin (10-04-2011)
  #7  
Old 10-02-2011, 01:06 PM
Pipette Filler
Points: 427, Level: 8 Points: 427, Level: 8 Points: 427, Level: 8
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2011
Posts: 8
Thanks: 1
Thanked 3 Times in 3 Posts
Default Re: Help in optimising PCR

Hello Butters,
Yes I have changed both the enzyme and the dntp's.Enzyme concentration is 2u/microlitre.I have checked the program and am sure that it is the same.

Thanks.
Reply With Quote
The Following User Says Thank You to Nita Rajakumar For This Useful Post:
admin (10-04-2011)
  #8  
Old 01-23-2013, 07:21 AM
Volunteer
Points: 932, Level: 17 Points: 932, Level: 17 Points: 932, Level: 17
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Mar 2012
Posts: 56
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: Help in optimising PCR

[Only registered users see links. ]The concentration of each primer should be between 0.1 and 0.5 mM. For most applications 0.2 mM produces satisfactory results. Too high primer concentrations increase the chance of mispriming, which results in nonspecific PCR products. Limiting primer concentrations result in extremely inefficient PCR reactions.
Reply With Quote
Reply

Tags
optimising , pcr


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump


All times are GMT. The time now is 04:36 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.15450 seconds with 15 queries