Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


GAPDH Primer Design Problem

GAPDH Primer Design Problem - PCR - Polymerase Chain Reaction Forum

GAPDH Primer Design Problem - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 02-19-2011, 03:16 PM
Pipette Filler
Points: 71, Level: 1 Points: 71, Level: 1 Points: 71, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2011
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Default GAPDH Primer Design Problem



Here is my protocol:

GAPDH Primer sequences:
GAPDH Forward- 5’CCACCCATGGCAAATTCCATGGCA 3’
GAPDH Reverse- 5’TCTAGACGGCAGGTCAGGTCCACC 3’

DNA: The genomic DNA you made

Make a 25 microliter master mix by adding the following to a PCR tube:

1. Use x microliter of DNA (1 microgram)
2. 2.5 microliter 10X PCR buffer
3. Use 2 microliter of MgCl2. (stock 25mM)
4. 2 microliter 2.5 mM dNTP (10X) (200 microM final)
5. 50 pmol Primer A (GAPDH forward)> final 2pmol /microliter
6. 50 pmol Primer B (GAPDH reverse)> final 2pmol /microliter
7. 0.5 microliter Taq Polymerase (5u/microliter stock)
8. Add PCR grade dd water to bring the total volume to 25 microliter.

Conditions:

97° C 5 m

25 cycles of:
97° C 1 min
60° C 1 min
72° C 1 min

These primers worked before, so I don't get it. Is there something wrong in the GC content? Oh, the cells are human lymphoblastoma and I'm amplifying GAPDH. The product is 598 bp in length.

Could it be the GC content is a little high? Or the annealing temperature is low? Or 3' ends of primer not complementary to the product of interest?
Reply With Quote
  #2  
Old 02-20-2011, 01:01 AM
Graduate Student
Points: 3,129, Level: 36 Points: 3,129, Level: 36 Points: 3,129, Level: 36
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Aug 2008
Posts: 108
Thanks: 4
Thanked 48 Times in 42 Posts
Default Re: GAPDH Primer Design Problem

What exactly is your problem now? Are you:

a. not getting any bands at all?

b. smearing/multiple bands?
Reply With Quote
The Following User Says Thank You to jonoave For This Useful Post:
admin (02-20-2011)
  #3  
Old 02-20-2011, 01:03 PM
Pipette Filler
Points: 71, Level: 1 Points: 71, Level: 1 Points: 71, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2011
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: GAPDH Primer Design Problem

I'm not getting any bands at all.
Reply With Quote
  #4  
Old 11-10-2011, 02:14 PM
Pipette Filler
Points: 2, Level: 1 Points: 2, Level: 1 Points: 2, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Nov 2011
Posts: 1
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: GAPDH Primer Design Problem

Hi,
your problem is with your input. your pcr product is 598bp when you use RNA. ıf you use dna, your pcr product will be 1102bp with introns. you can change your primers or you can extend 72° C 90 sec.
Reply With Quote
Reply

Tags
design , gapdh , primer , problem


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
PCR Primer Design Tools proatpcr Real-Time PCR and Quantitative PCR Forum 7 05-11-2011 08:17 PM
Degenerate primer design Tree_Truffle Molecular Cloning Forum 0 11-11-2009 06:45 PM
Real-time PCR Primer Design Software oBWhat Real-Time PCR and Quantitative PCR Forum 15 07-21-2009 10:52 AM
Rat primer design kliron PCR - Polymerase Chain Reaction Forum 3 11-02-2006 07:59 PM
PCR Primer Design List - which is best? PAO05 Bioinformatics 1 08-13-2006 05:13 AM


All times are GMT. The time now is 03:15 AM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.16960 seconds with 16 queries