GAPDH Primer Design Problem

[sciencegal7281]

Here is my protocol:

GAPDH Primer sequences:
GAPDH Forward- 5’CCACCCATGGCAAATTCCATGGCA 3’
GAPDH Reverse- 5’TCTAGACGGCAGGTCAGGTCCACC 3’

DNA: The genomic DNA you made

Make a 25 microliter master mix by adding the following to a PCR tube:

1. Use x microliter of DNA (1 microgram)
2. 2.5 microliter 10X PCR buffer
3. Use 2 microliter of MgCl2. (stock 25mM)
4. 2 microliter 2.5 mM dNTP (10X) (200 microM final)
5. 50 pmol Primer A (GAPDH forward)> final 2pmol /microliter
6. 50 pmol Primer B (GAPDH reverse)> final 2pmol /microliter
7. 0.5 microliter Taq Polymerase (5u/microliter stock)
8. Add PCR grade dd water to bring the total volume to 25 microliter.

Conditions:

97° C 5 m

25 cycles of:
97° C 1 min
60° C 1 min
72° C 1 min

These primers worked before, so I don't get it. Is there something wrong in the GC content? Oh, the cells are human lymphoblastoma and I'm amplifying GAPDH. The product is 598 bp in length.

Could it be the GC content is a little high? Or the annealing temperature is low? Or 3' ends of primer not complementary to the product of interest?

[jonoave]

What exactly is your problem now? Are you:

a. not getting any bands at all?

b. smearing/multiple bands?

[sciencegal7281]

I'm not getting any bands at all.

[tlnozkan]

Hi,
your problem is with your input. your pcr product is 598bp when you use RNA. ıf you use dna, your pcr product will be 1102bp with introns. you can change your primers or you can extend 72° C 90 sec.