Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.

pcr non specific amplification

pcr non specific amplification - PCR - Polymerase Chain Reaction Forum

pcr non specific amplification - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.

LinkBack Thread Tools Display Modes
Old 10-08-2010, 06:24 AM
Pipette Filler
Points: 449, Level: 8 Points: 449, Level: 8 Points: 449, Level: 8
Activity: 0% Activity: 0% Activity: 0%
Join Date: Mar 2010
Posts: 4
Thanks: 0
Thanked 1 Time in 1 Post
Question pcr non specific amplification

from past few weeks am finding difficulty in amplifying a 690bp fragment. am getting non specific amplification. even with a gradient i got non specific fragments. use of DMSO is also not helping in getting correct size amplicon.
Reply With Quote
The Following User Says Thank You to chinmayikaundinya For This Useful Post:
muhammad ilyas (05-05-2013)
Old 10-08-2010, 08:26 PM
Pipette Filler
Points: 370, Level: 7 Points: 370, Level: 7 Points: 370, Level: 7
Activity: 0% Activity: 0% Activity: 0%
Join Date: Jul 2010
Posts: 28
Thanks: 0
Thanked 1 Time in 1 Post
Default Re: pcr non specific amplification

There are many reasons for non specific amplification. Try to describe more exactly your pcr conditions (protocoll, molarity of primers, dntp, enzyme, amount of dna, type of dna, age of dna and primer and enzyme, storage conditions (buffer, temperature) of your components, molarity of monovalent and divalent salts you use, cycle number). Have you got any positive control. Is it working. What's with you negative control. Are there bands on gel ? The nonspecific bands youre are speaking of: Are they lower or upper of your desired band ?
Reply With Quote
Old 10-08-2010, 10:29 PM
luisillo's Avatar
Points: 4,061, Level: 42 Points: 4,061, Level: 42 Points: 4,061, Level: 42
Activity: 0% Activity: 0% Activity: 0%
Join Date: Jul 2010
Location: Mexico
Posts: 353
Thanks: 20
Thanked 98 Times in 90 Posts
Default Re: pcr non specific amplification

It might be your Mg+2 concentration: high Mg concentrations lead to unspecific amplifications. As Omicron says, it would be very useful for you to describe your pcr conditions in order to give you a more specific answer.
Reply With Quote
Old 10-11-2010, 06:52 AM
Pipette Filler
Points: 449, Level: 8 Points: 449, Level: 8 Points: 449, Level: 8
Activity: 0% Activity: 0% Activity: 0%
Join Date: Mar 2010
Posts: 4
Thanks: 0
Thanked 1 Time in 1 Post
Default Re: pcr non specific amplification

i hav used 5pmol/ul of primers, 2.5mM/ul primers, 2.5ng DNA, enzyme- taq and phusion pol. its a plasmid DNA. my positive control is working. am getng band of desired size and other non specific bands also. bt the desired band intensity is nt high.
Reply With Quote
Old 10-11-2010, 06:58 AM
Pipette Filler
Points: 449, Level: 8 Points: 449, Level: 8 Points: 449, Level: 8
Activity: 0% Activity: 0% Activity: 0%
Join Date: Mar 2010
Posts: 4
Thanks: 0
Thanked 1 Time in 1 Post
Default Re: pcr non specific amplification

the non specific bands are both upper and lower os the desired band size.
Reply With Quote
Old 10-13-2010, 08:23 PM
Pipette Filler
Points: 370, Level: 7 Points: 370, Level: 7 Points: 370, Level: 7
Activity: 0% Activity: 0% Activity: 0%
Join Date: Jul 2010
Posts: 28
Thanks: 0
Thanked 1 Time in 1 Post
Default Re: pcr non specific amplification

If 5 pmol/Ál primer is an end concentration it is very high (5ÁM), you should lower this. So high primer concentration can cause artifacts. But your positive control works. I'm not sure what 2.5mM/Ál primer means, but I would guess to 2.5mM MgCl2 ?? With phusion can be lowered to 1.5 I think. 2.5 ng DNA template seems to be okay. Your desired band isn't high because of the unspecific ones. Even if your positive control works, it could be a problem of Primer and/or Salt concentration, espeacially when the purity between sample and control differs great. In your case I would check purity first, then differ primer and salt conc. parameters.
Reply With Quote
Old 05-06-2013, 12:48 PM
Pipette Filler
Points: 65, Level: 1 Points: 65, Level: 1 Points: 65, Level: 1
Activity: 0% Activity: 0% Activity: 0%
Join Date: May 2013
Location: islamabad pakistan
Posts: 2
Thanks: 1
Thanked 0 Times in 0 Posts
Default Re: pcr non specific amplification

i am amplifying a 200bp gene KatG having a forward primer AGCTCGTATGGCACCGGAAC and a reverse primer AACGGGTCCGGGATGGTG 1.5 mM each primer , 200uM each DNTPse, 1U Taq under the following conditions
95 degree celcius for 4 minutes
94 for 20 seconds
59 for 30 seconds
72 for 1 minute
72 for 4 minutes
final 4. for hoding

but i am unable to achieve proper am amplification
i have tried to change DNTPse , MgCl2 concentration and primer con. but all in vain. hope you will guide me in a better way
Reply With Quote

amplification , pcr , specific

Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Weird amplification curve for Taqman probes fen Real-Time PCR and Quantitative PCR Forum 0 01-25-2010 09:35 AM
Calculations for specific activity Morales, Victor Protein Forum 0 10-02-2008 01:17 PM
no amplification or non specific band yucel PCR - Polymerase Chain Reaction Forum 3 03-24-2007 03:54 PM
non specific amplification in clone fragment using primer muhammad yasir Protocols and Methods Forum 1 12-21-2006 01:14 PM
non specific amplification in clone fragment using primer aganist vector WS Protocols and Methods Forum 0 12-16-2006 05:54 PM

All times are GMT. The time now is 12:03 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.15488 seconds with 16 queries