pcr non specific amplification

[chinmayikaundinya]

hi..
from past few weeks am finding difficulty in amplifying a 690bp fragment. am getting non specific amplification. even with a gradient i got non specific fragments. use of DMSO is also not helping in getting correct size amplicon.

[Omicron Lyrae]

There are many reasons for non specific amplification. Try to describe more exactly your pcr conditions (protocoll, molarity of primers, dntp, enzyme, amount of dna, type of dna, age of dna and primer and enzyme, storage conditions (buffer, temperature) of your components, molarity of monovalent and divalent salts you use, cycle number). Have you got any positive control. Is it working. What's with you negative control. Are there bands on gel ? The nonspecific bands youre are speaking of: Are they lower or upper of your desired band ?

[luisillo]

It might be your Mg+2 concentration: high Mg concentrations lead to unspecific amplifications. As Omicron says, it would be very useful for you to describe your pcr conditions in order to give you a more specific answer.

[chinmayikaundinya]

i hav used 5pmol/ul of primers, 2.5mM/ul primers, 2.5ng DNA, enzyme- taq and phusion pol. its a plasmid DNA. my positive control is working. am getng band of desired size and other non specific bands also. bt the desired band intensity is nt high.

[chinmayikaundinya]

the non specific bands are both upper and lower os the desired band size.

[Omicron Lyrae]

If 5 pmol/µl primer is an end concentration it is very high (5µM), you should lower this. So high primer concentration can cause artifacts. But your positive control works. I'm not sure what 2.5mM/µl primer means, but I would guess to 2.5mM MgCl2 ?? With phusion can be lowered to 1.5 I think. 2.5 ng DNA template seems to be okay. Your desired band isn't high because of the unspecific ones. Even if your positive control works, it could be a problem of Primer and/or Salt concentration, espeacially when the purity between sample and control differs great. In your case I would check purity first, then differ primer and salt conc. parameters.

[muhammad ilyas]

i am amplifying a 200bp gene KatG having a forward primer AGCTCGTATGGCACCGGAAC and a reverse primer AACGGGTCCGGGATGGTG 1.5 mM each primer , 200uM each DNTPse, 1U Taq under the following conditions
95 degree celcius for 4 minutes
94 for 20 seconds
59 for 30 seconds
72 for 1 minute
and
72 for 4 minutes
final 4. for hoding

but i am unable to achieve proper am amplification
i have tried to change DNTPse , MgCl2 concentration and primer con. but all in vain. hope you will guide me in a better way