Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Real Time PCR product size

Real Time PCR product size - PCR - Polymerase Chain Reaction Forum

Real Time PCR product size - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 02-08-2010, 03:37 PM
Pipette Filler
Points: 70, Level: 1 Points: 70, Level: 1 Points: 70, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2010
Posts: 5
Thanks: 0
Thanked 0 Times in 0 Posts
Default Real Time PCR product size



I have read that the optimal product size for the Real Time PCR is 75-150 bp. With the primers that I have picked, my product will be ~290 bp long. I was wondering if this would cause a major problem and/or if anyone else has been able to amplify in the qPCR with a large product.
Thank you!
Reply With Quote
  #2  
Old 02-08-2010, 10:12 PM
Aga's Avatar
Aga Aga is offline
Post-Doc
Points: 2,239, Level: 30 Points: 2,239, Level: 30 Points: 2,239, Level: 30
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Nov 2008
Posts: 270
Thanks: 25
Thanked 78 Times in 64 Posts
Default Re: Real Time PCR product size

This shouldn't be a problem. Yes, short products are better amplified in real - time PCR, but I managed to amplify 600pb just fine.
Reply With Quote
  #3  
Old 02-09-2010, 10:59 AM
Pipette Filler
Points: 1,961, Level: 27 Points: 1,961, Level: 27 Points: 1,961, Level: 27
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jan 2010
Location: Norway
Posts: 22
Thanks: 0
Thanked 4 Times in 4 Posts
Default Re: Real Time PCR product size

I think it depends on your PCR and what you're looking for. We can't use large products, the sensitivity gets worse in our PCR.
Reply With Quote
  #4  
Old 02-09-2010, 07:31 PM
Aga's Avatar
Aga Aga is offline
Post-Doc
Points: 2,239, Level: 30 Points: 2,239, Level: 30 Points: 2,239, Level: 30
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Nov 2008
Posts: 270
Thanks: 25
Thanked 78 Times in 64 Posts
Default Re: Real Time PCR product size

It depends on what you do. For HRM assays you can't use long products because of sensitivity, but HRM is used for genotyping usually. With probes or SYBR Green I, for standard gene detection, amplification of long DNA fragments is possible, but it somehow affects reaction efficiency.

You can have high specificity of this kind of reaction it if your primers and probes are very specific and don't form dimers.

I think you may succeed with the product around 250 - 300bp.
Reply With Quote
  #5  
Old 02-12-2010, 01:47 PM
Pipette Filler
Points: 70, Level: 1 Points: 70, Level: 1 Points: 70, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2010
Posts: 5
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: Real Time PCR product size

Thanks everybody!
Reply With Quote
  #6  
Old 02-13-2010, 12:37 PM
Pipette Filler
Points: 54, Level: 1 Points: 54, Level: 1 Points: 54, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2010
Location: Pennsylvania, USA
Posts: 2
Thanks: 0
Thanked 4 Times in 1 Post
Default Re: Real Time PCR product size

Dude...amplicon length directly correlates to PCR reaction efficiency. Generally we want as high an efficiency as possible if not maximal efficiency. We want this for several reasons; highly efficient PCR reactions are both more robust and more sensitive than less efficient reactions. Another reason we generally desire real-time PCR reactions at or near maximal efficiency is due to the quantitative method you are using with your experiment. If you're using a standard curve and doing absolute quantitation than whatever PCR efficiency your primers produce while achieving the sensitivity you desire, (assuming good template quality and absence of PCR inhibitors) is fine as long as the standards have the same efficiency. This is not always the case if you're using a synthetic standard. If you're using the comparative method of relative quantitation (ddCt) it's best practice (read critical) to use an endogenous reference assay within about 4% of the efficiency of your target of interest assay. Simply put it's easier to create assays with similar efficiency if they are at or near maximal efficiency. If your 290 bp assay has 86% efficiency (for example) it will be much harder to create an assay for your housekeeping gene that has a similar enough efficiency for the ddCt method to work properly without attempting efficiency correction (possible to do and not difficult but a suboptimal approach IMHO). If possible I'd redesign your primers to be closer to 150 bp unless you test your existing primer set's PCR efficiency using the Ct slope method and they are already producing PCR efficiency in excess of ....let's say 95%.
Reply With Quote
The Following 4 Users Say Thank You to vandergl For This Useful Post:
Aga (02-13-2010), Asterope (03-06-2012), Bonnie (02-23-2010), jonoave (12-22-2010)
  #7  
Old 02-13-2010, 03:11 PM
Pipette Filler
Points: 10, Level: 1 Points: 10, Level: 1 Points: 10, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2010
Posts: 7
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: Real Time PCR product size

..... i agree with vandergl. But, also depends on the type of
detection chosen. for example: taqman probes or Sybr green. because the fluorence detection is a diferent time of the amplification reaction.

and, depend of your objetives. melting curve, standar curve, etc...



Sorry, rigth now mi english level (writing) is no good
Reply With Quote
  #8  
Old 02-13-2010, 05:56 PM
Aga's Avatar
Aga Aga is offline
Post-Doc
Points: 2,239, Level: 30 Points: 2,239, Level: 30 Points: 2,239, Level: 30
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Nov 2008
Posts: 270
Thanks: 25
Thanked 78 Times in 64 Posts
Default Re: Real Time PCR product size

This is the basic rule to amplify the shortest DNA fragment possible in Real - time PCR. vandergl you're right, off course. But, as you stated, if the reaction has high efficiency with that length of the product its fine. I routinely use Real-time PCR assay with the product 290bp long and I get very high efficiency. It is possible and if the reaction is well designed it can stay like that.

Each reaction is different and whether it works or not always must be checked empirically.
Reply With Quote
The Following User Says Thank You to Aga For This Useful Post:
admin (02-23-2010)
  #9  
Old 02-22-2010, 04:26 PM
Pipette Filler
Points: 70, Level: 1 Points: 70, Level: 1 Points: 70, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2010
Posts: 5
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: Real Time PCR product size

I used MacVector to test my primers (I found new ones to make the product size smaller, however it is still higher than the recommended; it is 216 bp long)
I am using TaqMan, the endonucleases XhoI and NdeI and One-Step RT-PCR. My plans for the thermal cycling conditions include:

PCR
Step: AmpliTaq Gold Enzyme Activation ; Denature Anneal/Extend
Time: 10 min 15 sec 1 min
Temp: 95 C 95 C 60 C



(I'm very new to PCR and I just want to do it right so any advice would be greatly appreciated!!)

Primer 1 :5' ATTCCAGATTTACCTGAGAGAAG 3'
length: 23, %GC: 39.1, Gs: 5, Cs: 4, ambiguous G or C: 0
Tm: 48.3 deg C, (Of Primer itself)
1ug of primer is equivalent to 127.9 pmole of ends
Primer does not form Self 3'-dimer
Primer does not form Hairpin
Primer does not form Self Duplex
Primer binds at position 580 on the Top Strand (score 23)
Binding sites:
location score strand target sequence
1. 580 23 upper ATTCCAGATTTACCTGAGAGAAG

Primer 2 :5' AATACAACATCCGCACCAA 3'
length: 19, %GC: 42.1, Gs: 1, Cs: 7, ambiguous G or C: 0
Tm: 48.5 deg C, (Of Primer itself)
1ug of primer is equivalent to 156.4 pmole of ends
Primer does not form Self 3'-dimer
Primer does not form Hairpin
Primer does not form Self Duplex
Primer binds at position 795 on the Bottom Strand (score 19)
Binding sites:
location score strand target sequence
1. 777 19 lower AATACAACATCCGCACCAA

Primer pair details:
Major product size: 216 bp

The primers have a difference of .3 degrees C in Tm's.
Reply With Quote
  #10  
Old 02-22-2010, 04:30 PM
Pipette Filler
Points: 70, Level: 1 Points: 70, Level: 1 Points: 70, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2010
Posts: 5
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: Real Time PCR product size

I am also using gDNA))
Reply With Quote
Reply

Tags
pcr , product , real , size , time


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
the absolutely final complete collection of ideas blochee Physics Forum 2 06-15-2007 06:31 AM
the absolutely final complete collection of ideas blochee Physics Forum 0 06-14-2007 10:30 PM
The Achilles Heel of String Theory. S D Rodrian Physics Forum 7 07-08-2006 02:40 PM
Physicists Losing Their Grip?? Consc Physics Forum 218 01-06-2005 12:20 PM
The Special Theory of Relativity is dead Robert Calvert Physics Forum 162 01-05-2004 06:54 AM


All times are GMT. The time now is 10:19 AM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.25412 seconds with 16 queries