Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (http://www.molecularstation.com/forum/)
-   PCR - Polymerase Chain Reaction Forum (http://www.molecularstation.com/forum/pcr-polymerase-chain-reaction-forum/)
-   -   Real Time PCR product size (http://www.molecularstation.com/forum/pcr-polymerase-chain-reaction-forum/72396-real-time-pcr-product-size.html)

isabelkmetzger 02-08-2010 03:37 PM

Real Time PCR product size
 
I have read that the optimal product size for the Real Time PCR is 75-150 bp. With the primers that I have picked, my product will be ~290 bp long. I was wondering if this would cause a major problem and/or if anyone else has been able to amplify in the qPCR with a large product.
Thank you!

Aga 02-08-2010 10:12 PM

Re: Real Time PCR product size
 
This shouldn't be a problem. Yes, short products are better amplified in real - time PCR, but I managed to amplify 600pb just fine.

Aurora Borealis 02-09-2010 10:59 AM

Re: Real Time PCR product size
 
I think it depends on your PCR and what you're looking for. We can't use large products, the sensitivity gets worse in our PCR.

Aga 02-09-2010 07:31 PM

Re: Real Time PCR product size
 
It depends on what you do. For HRM assays you can't use long products because of sensitivity, but HRM is used for genotyping usually. With probes or SYBR Green I, for standard gene detection, amplification of long DNA fragments is possible, but it somehow affects reaction efficiency.

You can have high specificity of this kind of reaction it if your primers and probes are very specific and don't form dimers.

I think you may succeed with the product around 250 - 300bp.

isabelkmetzger 02-12-2010 01:47 PM

Re: Real Time PCR product size
 
Thanks everybody!

vandergl 02-13-2010 12:37 PM

Re: Real Time PCR product size
 
Dude...amplicon length directly correlates to PCR reaction efficiency. Generally we want as high an efficiency as possible if not maximal efficiency. We want this for several reasons; highly efficient PCR reactions are both more robust and more sensitive than less efficient reactions. Another reason we generally desire real-time PCR reactions at or near maximal efficiency is due to the quantitative method you are using with your experiment. If you're using a standard curve and doing absolute quantitation than whatever PCR efficiency your primers produce while achieving the sensitivity you desire, (assuming good template quality and absence of PCR inhibitors) is fine as long as the standards have the same efficiency. This is not always the case if you're using a synthetic standard. If you're using the comparative method of relative quantitation (ddCt) it's best practice (read critical) to use an endogenous reference assay within about 4% of the efficiency of your target of interest assay. Simply put it's easier to create assays with similar efficiency if they are at or near maximal efficiency. If your 290 bp assay has 86% efficiency (for example) it will be much harder to create an assay for your housekeeping gene that has a similar enough efficiency for the ddCt method to work properly without attempting efficiency correction (possible to do and not difficult but a suboptimal approach IMHO). If possible I'd redesign your primers to be closer to 150 bp unless you test your existing primer set's PCR efficiency using the Ct slope method and they are already producing PCR efficiency in excess of ....let's say 95%.

xsummer 02-13-2010 03:11 PM

Re: Real Time PCR product size
 
..... i agree with vandergl. But, also depends on the type of
detection chosen. for example: taqman probes or Sybr green. because the fluorence detection is a diferent time of the amplification reaction.

and, depend of your objetives. melting curve, standar curve, etc...



Sorry, rigth now mi english level (writing) is no good

Aga 02-13-2010 05:56 PM

Re: Real Time PCR product size
 
This is the basic rule to amplify the shortest DNA fragment possible in Real - time PCR. vandergl you're right, off course. But, as you stated, if the reaction has high efficiency with that length of the product its fine. I routinely use Real-time PCR assay with the product 290bp long and I get very high efficiency. It is possible and if the reaction is well designed it can stay like that.

Each reaction is different and whether it works or not always must be checked empirically.

isabelkmetzger 02-22-2010 04:26 PM

Re: Real Time PCR product size
 
I used MacVector to test my primers (I found new ones to make the product size smaller, however it is still higher than the recommended; it is 216 bp long)
I am using TaqMan, the endonucleases XhoI and NdeI and One-Step RT-PCR. My plans for the thermal cycling conditions include:

PCR
Step: AmpliTaq Gold Enzyme Activation ; Denature Anneal/Extend
Time: 10 min 15 sec 1 min
Temp: 95 C 95 C 60 C



(I'm very new to PCR and I just want to do it right so any advice would be greatly appreciated!!)

Primer 1 :5' ATTCCAGATTTACCTGAGAGAAG 3'
length: 23, %GC: 39.1, Gs: 5, Cs: 4, ambiguous G or C: 0
Tm: 48.3 deg C, (Of Primer itself)
1ug of primer is equivalent to 127.9 pmole of ends
Primer does not form Self 3'-dimer
Primer does not form Hairpin
Primer does not form Self Duplex
Primer binds at position 580 on the Top Strand (score 23)
Binding sites:
location score strand target sequence
1. 580 23 upper ATTCCAGATTTACCTGAGAGAAG

Primer 2 :5' AATACAACATCCGCACCAA 3'
length: 19, %GC: 42.1, Gs: 1, Cs: 7, ambiguous G or C: 0
Tm: 48.5 deg C, (Of Primer itself)
1ug of primer is equivalent to 156.4 pmole of ends
Primer does not form Self 3'-dimer
Primer does not form Hairpin
Primer does not form Self Duplex
Primer binds at position 795 on the Bottom Strand (score 19)
Binding sites:
location score strand target sequence
1. 777 19 lower AATACAACATCCGCACCAA

Primer pair details:
Major product size: 216 bp

The primers have a difference of .3 degrees C in Tm's.

isabelkmetzger 02-22-2010 04:30 PM

Re: Real Time PCR product size
 
I am also using gDNA))


All times are GMT. The time now is 12:56 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.13173 seconds with 11 queries