Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Can anyone help me to correct my primer design?

Can anyone help me to correct my primer design? - PCR - Polymerase Chain Reaction Forum

Can anyone help me to correct my primer design? - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 12-12-2009, 09:50 AM
Pipette Filler
Points: 8, Level: 1 Points: 8, Level: 1 Points: 8, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2009
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Default Can anyone help me to correct my primer design?



Hello everyone, I am just starting learning to design primer. But I still have problem with reverse primer design.
If I have sequence like this
5’ GATAGTGGTTGCGTTGTGAGCTGGAAAAAAAAGAACTGAAATGTGGCAGTTGGTCAACTCCTTGGTCACAGCT 3’
If I use start codon ATG and ACTAGT as restriction enzyme, my forward primer should be 5’ ACTAGT ATG GAT AGT GGT TGC GTT GTG 3’
If I use TAA as stop codon and CGGCCG as restriction enzyme, my reverse primer should be 5’ GCCGGC AAT AGC TGT GAC CAA GGA GTT 3’
Please help and I will be happy to have your suggestion. Thank you.
Reply With Quote
  #2  
Old 01-12-2010, 03:48 PM
butters's Avatar
Post-Doc
Points: 4,159, Level: 43 Points: 4,159, Level: 43 Points: 4,159, Level: 43
Activity: 33% Activity: 33% Activity: 33%
 
Join Date: Dec 2008
Location: Malaysia
Posts: 298
Thanks: 23
Thanked 67 Times in 62 Posts
Default Re: Can anyone help me to correct my primer design?

Quote:
Hello everyone, I am just starting learning to design primer. But I still have problem with reverse primer design.
If I have sequence like this
5’ GATAGTGGTTGCGTTGTGAGCTGGAAAAAAAAGAACTGAAATGTGGCAGT TGGTCAACTCCTTGGTCACAGCT 3’
If I use start codon ATG and ACTAGT as restriction enzyme, my forward primer should be 5’ ACTAGT ATG GAT AGT GGT TGC GTT GTG 3’
If I use TAA as stop codon and CGGCCG as restriction enzyme, my reverse primer should be 5’ GCCGGC AAT AGC TGT GAC CAA GGA GTT 3’
Please help and I will be happy to have your suggestion. Thank you.
for reverse primer it should be
5' CGGCCGTAAAACTCCTTGGTCACAGCT 3'
HOWEVER
to order for primer u should use
5' AGCTGTGACCAAGGAGTTTTACGGCCG 3'

i would like to stress that u have to take into consideration the cutting site for the enzyme as in this page [Only registered users see links. ]. Good luck!! It would be best if we have more data we may be able to help you especially with more data
Reply With Quote
  #3  
Old 01-12-2010, 09:12 PM
Moleecule's Avatar
Pipette Filler
Points: 2,272, Level: 30 Points: 2,272, Level: 30 Points: 2,272, Level: 30
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jan 2007
Location: San Jose
Posts: 13
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: Can anyone help me to correct my primer design?

Your primer design is fine for both forward and reverse primers but you would need to add few more bases before (5' of) the REN sites as most enzymes need an overhang to cut. And you do not need to rev. complement the REN site sequence as 'butters' pointed out.
Reply With Quote
Reply

Tags
correct , design , primer , primers


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Can anyone help me to correct my primer design? confusing Bioinformatics 0 12-12-2009 11:21 AM
Bad primer design ? How can I know ? surt Bioinformatics 4 10-07-2009 07:24 AM
How to design primer? af malik PCR - Polymerase Chain Reaction Forum 3 01-29-2009 10:11 AM
Primer design software Josh Levin Protocols and Methods Forum 0 01-08-2009 01:31 PM
Diferential primer design Yoram Gerchman Protocols and Methods Forum 1 09-01-2007 01:56 AM


All times are GMT. The time now is 09:03 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.16949 seconds with 16 queries