Can anyone help me to correct my primer design?

[confusing]

Hello everyone, I am just starting learning to design primer. But I still have problem with reverse primer design.
If I have sequence like this
5’ GATAGTGGTTGCGTTGTGAGCTGGAAAAAAAAGAACTGAAATGTGGCAGTTGGTCAACTCCTTGGTCACAGCT 3’
If I use start codon ATG and ACTAGT as restriction enzyme, my forward primer should be 5’ ACTAGT ATG GAT AGT GGT TGC GTT GTG 3’
If I use TAA as stop codon and CGGCCG as restriction enzyme, my reverse primer should be 5’ GCCGGC AAT AGC TGT GAC CAA GGA GTT 3’
Please help and I will be happy to have your suggestion. Thank you.

[butters]

Hello everyone, I am just starting learning to design primer. But I still have problem with reverse primer design.
If I have sequence like this
5’ GATAGTGGTTGCGTTGTGAGCTGGAAAAAAAAGAACTGAAATGTGGCAGT TGGTCAACTCCTTGGTCACAGCT 3’
If I use start codon ATG and ACTAGT as restriction enzyme, my forward primer should be 5’ ACTAGT ATG GAT AGT GGT TGC GTT GTG 3’
If I use TAA as stop codon and CGGCCG as restriction enzyme, my reverse primer should be 5’ GCCGGC AAT AGC TGT GAC CAA GGA GTT 3’
Please help and I will be happy to have your suggestion. Thank you.

for reverse primer it should be
5' CGGCCGTAAAACTCCTTGGTCACAGCT 3'
HOWEVER
to order for primer u should use
5' AGCTGTGACCAAGGAGTTTTACGGCCG 3'

i would like to stress that u have to take into consideration the cutting site for the enzyme as in this page [Only registered users see links. ]. Good luck!! It would be best if we have more data we may be able to help you especially with more data

[Moleecule]

Your primer design is fine for both forward and reverse primers but you would need to add few more bases before (5' of) the REN sites as most enzymes need an overhang to cut. And you do not need to rev. complement the REN site sequence as 'butters' pointed out.