Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > PCR - Polymerase Chain Reaction Forum
Register Search Today's Posts Mark Forums Read

PCR - Polymerase Chain Reaction Forum PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


How to design primer?

How to design primer? - PCR - Polymerase Chain Reaction Forum

How to design primer? - PCR - Polymerase Chain Reaction Forum. Discuss and ask questions about PCR troubleshooting, PCR protocols and methods, PCR products, and PCR theory.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 01-08-2009, 03:51 AM
Pipette Filler
Points: 2,540, Level: 32 Points: 2,540, Level: 32 Points: 2,540, Level: 32
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jun 2008
Location: Rawalpindi, PAKISTAN
Posts: 26
Thanks: 1
Thanked 1 Time in 1 Post
Default How to design primer?



Hi,
plz tell me how we calculate the length of the priner on the basis of the genome size?How Tm affect the primer?Is it possible that if Tm,3' stability and other conditions necessary for primer design are given then on the basis of this can we calculate the primer length?Also tell me reverse complement primer?How we can design primer and what conditions we have to take into account?
awaiting,
af malik
Reply With Quote
  #2  
Old 01-20-2009, 08:49 AM
moleculardude's Avatar
M.D/Ph.D
 
Join Date: Jul 2006
Location: Melbourne Australia
Posts: 423
Thanks: 5
Thanked 10 Times in 8 Posts
Default Re: How to design primer?

Hello Af Malik,
these are good questions.

Some ideas on primer design:

Primers should be about 17-28 bases in length - but can often be longer.
Try to get a base composition at about 50-60% (G+C) - if your sequence is very GC rich then you may have no choice.
The primers should end (at the 3') in a G or C, or CG or GC. This addition of a GC prevents "breathing" of ends and increases efficiency of priming.
Tms between 55-80oC are preferred.
3'-ends of primers should not be complementary.
Avoid primer self-complementarity.
Check your primers with oligoanalyzer (link below)

I would design my primers and then use this program:
[Only registered users see links. ]
Reply With Quote
  #3  
Old 01-29-2009, 08:17 AM
Banned
Points: 27, Level: 1 Points: 27, Level: 1 Points: 27, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jan 2009
Posts: 6
Thanks: 0
Thanked 0 Times in 0 Posts
Default Re: How to design primer?

Hey,
try to use the MeltCalc sofware to reverse your primers and get the annealing temperature. Try to keep the relation GC to AT at ca. 50% and the length of the primer arround 18-20 nucleotides.

Cheers
Heidi
Reply With Quote
  #4  
Old 01-29-2009, 11:11 AM
NATHANALANPATRICKROGERS's Avatar
Summer Student
Points: 306, Level: 6 Points: 306, Level: 6 Points: 306, Level: 6
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jan 2009
Location: Maroochydore
Posts: 73
Thanks: 4
Thanked 13 Times in 11 Posts
Default Re: How to design primer?

Quote:
Originally Posted by af malik View Post
Also tell me reverse complement primer?
A few cut/paste pointers, but important nonetheless...

Often we need to obtain the complementary strand of a DNA sequence [to boost yield, I presume - NAPR ]. As DNA is antiparallel, we really need the reverse complement sequence to keep our 5' and 3' ends properly oriented.

Original Sequence 5'ATGCAGGGGAAACATGATTCAGGAC 3'

Complement 3'TACGTCCCCTTTGTACTAAGTCCTG 5'

(Pairs with Original Sequence, antiparallel)

Reverse Complement 5'GTCCTGAATCATGTTTCCCCTGCAT 3'

(Complement sequence written 5' to 3')

A group of degenerate oligonucleotides contain related sequences with differences at specific locations. These are used simultaneously in the hope that one of the sequences of the oligonucleotides will be perfectly complementary to a target DNA sequence.

One common use of degenerate oligonucleotides is when the amino acid sequence of a protein is known. One can reverse translate this sequence to determine all of the possible nucleotide sequences that could encode that amino acid sequence. A set of degenerate oligonucleotides would then be produced matching those DNA sequences.

Also keep in mind that most oligonucleotide synthesis reactions are only 98% efficient. This means that each time a base is added, only 98% of the oligos will receive the base. This is not often critical with shorter oligos, but as length increases, so does the probability that a primer will be missing a base.

Oligonucleotide length / Percent with correct sequence

10 bases / (0.98)pwr10 = 81.7%

20 bases / (0.98)pwr20 = 66.7%

30 bases / (0.98)pwr30 = 54.6%

40 bases / (0.98)pwr40 = 44.6%
Reply With Quote
Reply

Tags
design , primer , reverse complement


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
qPCR primer design tutorial mooseo Real-Time PCR and Quantitative PCR Forum 4 08-18-2012 07:31 PM
Can anyone help me to correct my primer design? confusing PCR - Polymerase Chain Reaction Forum 2 01-12-2010 10:12 PM
Can anyone help me to correct my primer design? confusing Bioinformatics 0 12-12-2009 12:21 PM
Bad primer design ? How can I know ? surt Bioinformatics 4 10-07-2009 07:24 AM
Primer design software Josh Levin Protocols and Methods Forum 0 01-08-2009 02:31 PM


All times are GMT. The time now is 05:32 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.14034 seconds with 16 queries