| | |||||||
| Register | Search | Today's Posts | Mark Forums Read |
| Molecular Biology Techniques Molecular Biology Forum. Includes forums for common molecular biology techniques. |
| | LinkBack | Thread Tools | Display Modes |
|
#1
| |||||||||||
| |||||||||||
| Hi I have been trying to clone a pcr product of 3065bp in pEF6V5 His TOPO vector. I have tried everything but couldnt amplify my product with normal taq. I have tried phusion (neb), recombinant taq (fermentas, sigma, invitrogen, intron biotech), dreamtaq (fermentas), platinum taq (invitrogen) and also Ex taq from takara but in vain as none gave any result. Thought phusion (neb) gives band of same size as required but it can not be cloned in TOPO due to 3'A missing. based on many TOPO related forums i tried to standardize ploy A addition after amplifying my product with phusion (neb) but in vain! What i am looking for is some taq polymerase or some way by which i can amplify my pcr product with any normal taq. My primers are Fwd: 5’ ACATGCTTTGGGACTGCCACTGA 3’ Rev: 5’ GCCGGCAATGGACGTGAACA 3’ I am using 1x buffer, 2.5mM mgcl2, 1.25ul (0.5 uM) primers, 0.25mM dntp, 1U/ul Taq, 1ul (<500ng) template (cDNA) for a 25ul reaction. The pcr conditions are 94 - 4 mins 94 - 45 secs X - 30 72 - Y mins 72 - 10 mins 4 - hold I have tried gradient of X from 55 to 68 but no result. And Y from 2 to 4 minutes but no result. Pls suggest. Thanks Mansi Last edited by admin; 02-09-2013 at 02:39 AM. |
| Tags |
| amplify , clone , pcr , stuck , urgently |
| Thread Tools | |
| Display Modes | |
|
|
| | ||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| Agarose gel stuck on UV transilluminator | xuxux | Agarose Gel Electrophoresis Forum | 2 | 01-15-2013 10:02 AM |
| EtBr 'stuck' in gel | MoshiMoshiMike | Agarose Gel Electrophoresis Forum | 2 | 09-18-2010 09:58 AM |
| Need Cy/Pm;D/Sb urgently | Nusrat Malik | Drosophila Forum | 0 | 08-31-2007 06:14 PM |
| Removing Stuck Sorvall GSA Rotor | rmagnus@netzero.com | Protocols and Methods Forum | 0 | 05-03-2007 07:58 PM |
| Why will a stuck solenoid draw excessive amps? | cobaltfjord | Physics Forum | 1 | 01-04-2006 12:13 PM |