Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Molecular Biology Techniques
Register Search Today's Posts Mark Forums Read

Molecular Biology Techniques Molecular Biology Forum. Includes forums for common molecular biology techniques.


Stuck Cannot Amplify Pcr Clone Need help urgently!

Stuck Cannot Amplify Pcr Clone Need help urgently! - Molecular Biology Techniques

Stuck Cannot Amplify Pcr Clone Need help urgently! - Molecular Biology Forum. Includes forums for common molecular biology techniques.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 02-05-2013, 12:04 PM
Pipette Filler
Points: 62, Level: 1 Points: 62, Level: 1 Points: 62, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Feb 2013
Posts: 4,294,967,295
Thanks: 0
Thanked 0 Times in 0 Posts
Default Stuck Cannot Amplify Pcr Clone Need help urgently!



Hi

I have been trying to clone a pcr product of 3065bp in pEF6V5 His TOPO vector. I have tried everything but couldnt amplify my product with normal taq. I have tried phusion (neb), recombinant taq (fermentas, sigma, invitrogen, intron biotech), dreamtaq (fermentas), platinum taq (invitrogen) and also Ex taq from takara but in vain as none gave any result. Thought phusion (neb) gives band of same size as required but it can not be cloned in TOPO due to 3'A missing.
based on many TOPO related forums i tried to standardize ploy A addition after amplifying my product with phusion (neb) but in vain!
What i am looking for is some taq polymerase or some way by which i can amplify my pcr product with any normal taq.
My primers are Fwd: 5’ ACATGCTTTGGGACTGCCACTGA 3’
Rev: 5’ GCCGGCAATGGACGTGAACA 3’

I am using 1x buffer, 2.5mM mgcl2, 1.25ul (0.5 uM) primers, 0.25mM dntp, 1U/ul Taq, 1ul (<500ng) template (cDNA) for a 25ul reaction.

The pcr conditions are
94 - 4 mins
94 - 45 secs
X - 30
72 - Y mins
72 - 10 mins
4 - hold

I have tried gradient of X from 55 to 68 but no result. And Y from 2 to 4 minutes but no result.

Pls suggest.
Thanks
Mansi

Last edited by admin; 02-09-2013 at 02:39 AM.
Reply With Quote
Reply

Tags
amplify , clone , pcr , stuck , urgently


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Agarose gel stuck on UV transilluminator xuxux Agarose Gel Electrophoresis Forum 2 01-15-2013 10:02 AM
EtBr 'stuck' in gel MoshiMoshiMike Agarose Gel Electrophoresis Forum 2 09-18-2010 09:58 AM
Need Cy/Pm;D/Sb urgently Nusrat Malik Drosophila Forum 0 08-31-2007 06:14 PM
Removing Stuck Sorvall GSA Rotor rmagnus@netzero.com Protocols and Methods Forum 0 05-03-2007 07:58 PM
Why will a stuck solenoid draw excessive amps? cobaltfjord Physics Forum 1 01-04-2006 12:13 PM


All times are GMT. The time now is 09:19 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.15365 seconds with 16 queries