Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Molecular Biology Techniques
Register Search Today's Posts Mark Forums Read

Molecular Biology Techniques Molecular Biology Forum. Includes forums for common molecular biology techniques.


Northern blot problem

Northern blot problem - Molecular Biology Techniques

Northern blot problem - Molecular Biology Forum. Includes forums for common molecular biology techniques.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 04-25-2011, 09:12 AM
Pipette Filler
Points: 2,004, Level: 28 Points: 2,004, Level: 28 Points: 2,004, Level: 28
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Oct 2008
Posts: 9
Thanks: 1
Thanked 0 Times in 0 Posts
Default Northern blot problem



Hello everyone
i am performing [of course not for the first time] northern blot, but i am stuck on one of the most basic step, that is control, i am using U6B as a normalizing control,
U6B GCAGGGGCCATGCTAATCTTCTCTGTATCG

this is the probe sequence i am using, but unfortunately everytime i am getting nothing in the mature form region, here is the picture of blot i am getting,

i have performed this expression twise till now but still stuck with the same results. for your information, i am getting good bands at the mature region for other miRNA probes.

i will appreciate if anyone can suggest me something.

Thanks in advance.
Reply With Quote
Reply

Tags
blot , northern , problem


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Northern Blot Problem - Help!!!! Akaleesh Protocols and Methods Forum 1 07-23-2008 12:03 PM
Problem With Northern Blot - Help!!!! Akaleesh Agarose Gel Electrophoresis Forum 0 07-22-2008 08:39 PM
Problems doing Northern Blot with small probes (oligo, riboprobe,PCR and random primed) Sharon Protocols and Methods Forum 1 02-12-2008 08:44 AM
Northern blot ready-to-use Isabella Della Noce Zebrafish Forum 0 07-20-2004 04:11 PM
replies to indoor pest problem Dan Riggs Arabidopsis and Plant Biology 0 06-22-2004 04:59 PM


All times are GMT. The time now is 03:25 AM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.11257 seconds with 16 queries