Polymerase Chain Reaction - lab for students

[domba]

Materials:

1. Taq (or other) PCR enzyme (5 Units/ul)
2. PCR enzyme reaction buffer
3. Distilled water (nuclease free)
4. DNA to be used as template, such as GAPDH template from Clontech
5. DNA to be used as upstream and downstream primers, such as the corresponding primers set for GAPDH template from ClontechTeacher's note: Upstream: accacagtccatgccatcac; Downstream: tccaccaccctgttgctgta.
6. Light mineral oil (nuclease free)
7. dNTP mix (10 mM of each dNTP)

Supplies:

1. PCR machine and the 600-ul tubes for use in the machine
2. Micropipetter and tips
3. Microcentrifuge with adaptors for 600-ul tubes

Procedures:

1. Set up the following 2 reactions (final volume of 50 ul each):Teacher's note: Care should be taken to avoid cross contamination.

Sample Control
==================================================
distilled water 40 ul 42 ul
10 X PCR enzyme reaction buffer 5 ul 5 ul
dNTP mix 1 ul 1 ul
PCR enzyme 0.25 ul 0.25 ul

2. Tab tubes gently to mix and spin for 2 seconds in a microcentrifuge.
3. Add:Teacher's note: Care should be taken to avoid cross contamination.

Sample Control
==================================================
downstream primer stock (50 uM) 1 ul 1 ul
upstream primer stock (50 uM) 1 ul 1 ul
template (at a concentration of 0.5-2 ng/10 ul) 2 ul 0 ul

4. Overlay each tube with 1-2 drops (20-40 ul) of mineral oil.Teacher's note: Care should be taken to avoid cross contamination.
5. Place the tubes in PCR machine.
6. Set up the following profile for 30 cycles:Teacher's note: This profile works well with GAPDH template DNA, other template may require need modification based on empirical tests.
* 45 seconds at 94 C
* 45 seconds at 60 C
* 2 minutes at 72 C
7. Withdraw 5 ul from each of the reactions at 15 cycles and store at 4 degrees C.
8. Withdraw 5 ul from each of the reactions at 20 cycles and store at 4 degrees C.
9. Withdraw 5 ul from each of the reactions at 25 cycles and store at 4 degrees C.
10. Store the remaining at 4 degrees C when all 30 cycles are completed.
11. Perform agarose gel electrophoresis later using the stored reaction mixture.

Results

1. After agarose gel electrophoresis, a band of expected size (452 basepairs) should be seen in the "sample" but not in the "control".