Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Molecular Biology Articles and Protocols
Register Search Today's Posts Mark Forums Read

Molecular Biology Articles and Protocols Post Molecular Biology and science Protocols, Reviews, and Articles Forum. You can be the author!

Polymerase Chain Reaction - lab for students

Polymerase Chain Reaction - lab for students - Molecular Biology Articles and Protocols

Polymerase Chain Reaction - lab for students - Post Molecular Biology and science Protocols, Reviews, and Articles Forum. You can be the author!

LinkBack Thread Tools Display Modes
Old 07-31-2006, 11:02 PM
Pipette Filler
Points: 2,792, Level: 34 Points: 2,792, Level: 34 Points: 2,792, Level: 34
Activity: 0% Activity: 0% Activity: 0%
Join Date: Jul 2006
Posts: 26
Thanks: 0
Thanked 3 Times in 2 Posts
Post Polymerase Chain Reaction - lab for students


1. Taq (or other) PCR enzyme (5 Units/ul)
2. PCR enzyme reaction buffer
3. Distilled water (nuclease free)
4. DNA to be used as template, such as GAPDH template from Clontech
5. DNA to be used as upstream and downstream primers, such as the corresponding primers set for GAPDH template from ClontechTeacher's note: Upstream: accacagtccatgccatcac; Downstream: tccaccaccctgttgctgta.
6. Light mineral oil (nuclease free)
7. dNTP mix (10 mM of each dNTP)


1. PCR machine and the 600-ul tubes for use in the machine
2. Micropipetter and tips
3. Microcentrifuge with adaptors for 600-ul tubes


1. Set up the following 2 reactions (final volume of 50 ul each):Teacher's note: Care should be taken to avoid cross contamination.

Sample Control
distilled water 40 ul 42 ul
10 X PCR enzyme reaction buffer 5 ul 5 ul
dNTP mix 1 ul 1 ul
PCR enzyme 0.25 ul 0.25 ul

2. Tab tubes gently to mix and spin for 2 seconds in a microcentrifuge.
3. Add:Teacher's note: Care should be taken to avoid cross contamination.

Sample Control
downstream primer stock (50 uM) 1 ul 1 ul
upstream primer stock (50 uM) 1 ul 1 ul
template (at a concentration of 0.5-2 ng/10 ul) 2 ul 0 ul

4. Overlay each tube with 1-2 drops (20-40 ul) of mineral oil.Teacher's note: Care should be taken to avoid cross contamination.
5. Place the tubes in PCR machine.
6. Set up the following profile for 30 cycles:Teacher's note: This profile works well with GAPDH template DNA, other template may require need modification based on empirical tests.
* 45 seconds at 94 C
* 45 seconds at 60 C
* 2 minutes at 72 C
7. Withdraw 5 ul from each of the reactions at 15 cycles and store at 4 degrees C.
8. Withdraw 5 ul from each of the reactions at 20 cycles and store at 4 degrees C.
9. Withdraw 5 ul from each of the reactions at 25 cycles and store at 4 degrees C.
10. Store the remaining at 4 degrees C when all 30 cycles are completed.
11. Perform agarose gel electrophoresis later using the stored reaction mixture.


1. After agarose gel electrophoresis, a band of expected size (452 basepairs) should be seen in the "sample" but not in the "control".
Reply With Quote

chain , lab , polymerase , reaction , students

Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
The polymerase chain reaction (PCR) requires __________ and __________ to be Receive PCR - Polymerase Chain Reaction Forum 7 10-21-2009 06:28 AM
The polymerase chain reaction (PCR) requires __________ and __________ to be... Receive PCR - Polymerase Chain Reaction Forum 1 09-02-2009 05:01 AM
The polymerase chain reaction (PCR) requires __________ and __________ to be... Receive PCR - Polymerase Chain Reaction Forum 2 08-28-2009 06:07 PM
PCR World-Everything about Polymerase Chain Reaction peterish PCR - Polymerase Chain Reaction Forum 0 11-27-2008 09:12 PM
Polymerase chain reaction admin Article Discussion 0 03-16-2007 04:31 AM

All times are GMT. The time now is 12:43 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2015, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.11854 seconds with 16 queries