Molecular Biology Forum Life Science Forums - Peptide Forum http://www.molecularstation.com/forum/ Peptide Forum. Ask and discuss questions on peptide protocols, custom peptide synthesis, peptide identification and peptide sequencing. en Sat, 21 Nov 2009 02:28:47 GMT vBulletin 60 http://www.molecularstation.com/forum/images/misc/rss.jpg Molecular Biology Forum Life Science Forums - Peptide Forum http://www.molecularstation.com/forum/ <![CDATA[Can the bond between proline's amine end with another amino acid be called a peptide]]> http://www.molecularstation.com/forum/peptide-forum/71853-can-bond-between-prolines-amine-end-another-amino-acid-called-peptide.html Tue, 17 Nov 2009 17:16:35 GMT bond? If not, does that explain why in biuret reaction, by using casein (which contain more proline) I got less intense violet coloration in...
bond? If not, does that explain why in biuret reaction, by using casein (which contain more proline) I got less intense violet coloration in comparison to albumin?
]]> Peptide Forum hypnonebula http://www.molecularstation.com/forum/peptide-forum/71853-can-bond-between-prolines-amine-end-another-amino-acid-called-peptide.html Please help: If a peptide occurs in one of your cells that is 50 amino acids long...? http://www.molecularstation.com/forum/peptide-forum/71833-please-help-if-peptide-occurs-one-your-cells-50-amino-acids-long.html Mon, 16 Nov 2009 18:16:15 GMT If a peptide occurs in one of your cells that is 50 amino acids long, what is the minimum number of nucleotides that would have been required for...
If a peptide occurs in one of your cells that is 50 amino acids long, what is the minimum number of nucleotides that would have been required for efficient translation?

A. 50
B. 51
C. 54
D. 150
E. 151
F. 154 -- This is the answer

The answer is 154, but I'm not sure how to get that answer. If someone could help me understand this, I would really appreciate it! Thanks so much!
]]> Peptide Forum Hope http://www.molecularstation.com/forum/peptide-forum/71833-please-help-if-peptide-occurs-one-your-cells-50-amino-acids-long.html Double stranded DNA sequence show a gene encoding a small peptide.The... http://www.molecularstation.com/forum/peptide-forum/71824-double-stranded-dna-sequence-show-gene-encoding-small-peptide.html Sun, 15 Nov 2009 02:19:41 GMT
...three stop codons are UAA,UAG, and UGA? 5'ATGACGTATAATCACCGTAGATAACAGTAATTGATAAATCAG 3'
3'TACTGCATATTAGTGGCATCTATTGTCATTAACTATTTAGTC 5'

How many amino acids long will the small protein be that is encoded by this gene?
]]> Peptide Forum Mandyy http://www.molecularstation.com/forum/peptide-forum/71824-double-stranded-dna-sequence-show-gene-encoding-small-peptide.html Out of aldosterone, angiotensin II, antidiuretic hormone, and atrial... http://www.molecularstation.com/forum/peptide-forum/71822-out-aldosterone-angiotensin-ii-antidiuretic-hormone-atrial.html Sat, 14 Nov 2009 15:18:22 GMT ...natriuretic peptide, what lower...? Out of aldosterone, angiotensin II, antidiuretic hormone, and atrial natriuretic peptide, what lower blood...
...natriuretic peptide, what lower...? Out of aldosterone, angiotensin II, antidiuretic hormone, and atrial natriuretic peptide, what lower blood pressure?
]]> Peptide Forum Greg http://www.molecularstation.com/forum/peptide-forum/71822-out-aldosterone-angiotensin-ii-antidiuretic-hormone-atrial.html Peptide synthesis in the solid phase? http://www.molecularstation.com/forum/peptide-forum/71798-peptide-synthesis-solid-phase.html Wed, 11 Nov 2009 19:18:26 GMT Hello YA, I am writing a paper on SPPS for a 4th year organic chemistry course and have finally run into a brick wall. All of the abstracts...
Hello YA,

I am writing a paper on SPPS for a 4th year organic chemistry course and have finally run into a brick wall.

All of the abstracts relevant to what I am trying to portray constantly mentions T-bag method Can someone please explain this to me, or direct me to an article that can. Best answer WILL be chosen and full points awarded to the best answer I get ( if I only get one answer and its shit I will still give it best answer!) so fire away my colleagues
]]> Peptide Forum Josh W http://www.molecularstation.com/forum/peptide-forum/71798-peptide-synthesis-solid-phase.html