Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > General Science Forums > Biochemistry Forum > DNA Forum
Register Search Today's Posts Mark Forums Read

DNA Forum Discuss DNA, the molecule of hereditary. Topics include DNA structure, DNA replication, DNA function.

BLAST query problem

BLAST query problem - DNA Forum

BLAST query problem - Discuss DNA, the molecule of hereditary. Topics include DNA structure, DNA replication, DNA function.

LinkBack Thread Tools Display Modes
Old 08-08-2011, 12:19 PM
Pipette Filler
Points: 4, Level: 1 Points: 4, Level: 1 Points: 4, Level: 1
Activity: 0% Activity: 0% Activity: 0%
Join Date: Aug 2011
Posts: 1
Thanks: 0
Thanked 0 Times in 0 Posts
Default BLAST query problem

Hey guys,

sry for my probably simple question, but i got some serious problem with a certain BLAST query.

I searching for the best spots to place two opposing zinc finger nucleases in a certain gene.

Screening for the very sequences is done by ZiFiT, no problem.


The first nine nucleotids are for the first protein, then a spacer and the second protein.

Now I need to get sure, that there a few as possible other sequences in the whole genome that are the same or similiar.
I need the two nucleases be as specific as possible.

Therefore I blast the sequence.

Since these proteins need to dimerize to work, I don't care, if the first part or the second part of the sequence happen to be somewhere else isolated too.

I'm only interested if both parts, with the proper spacer in between, happen to be somewhere else too, or similiar sequences respectively.

Now blastn gives me both results.

It gives me the one I'm interested in, like that:
Score = 23.8 bits (12),  Expect =  2498
 Identities = 18/24 (75%), Gaps = 0/24 (0%)

                 |||||||||      |||||||||
Sbjct  93104646  CGCGACCCCGTCCCGGGCGCGGCC  93104669

but it also gives me the short ones, i'm not interested in, like that:
 Score = 18.0 bits (9),  Expect = 136135
 Identities = 9/9 (100%), Gaps = 0/9 (0%)

Query  16       GGCGCGGCC  24
Sbjct  1800501  GGCGCGGCC  1800493

So, basically what I need, is how to restrict the results to a certain lenght, I guess (not to a certain minimum amount of identity, but just to a minimum amount of length as a wohle).

Again, sry for my simple question, but I tried a lot, and just haven't come to an end yet.

It would be awesome if someone could give me a hint how to do that.
Reply With Quote

blast , problem , query

Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Problem with site-directed mutagenesis PCR pwichai PCR - Polymerase Chain Reaction Forum 0 01-20-2011 08:20 AM
Real-time standard curve amplification problem? bdietzpu Molecular Station Suggestion Forum 0 11-03-2010 10:05 PM
autoflex III MALDI TOF/TOF LIFT mode, high voltage problem emin atik Mass Spectrometry Forum 0 06-24-2010 07:39 AM
Another contimation problem helpme Cell Biology and Cell Culture 1 05-17-2010 09:53 AM
HELP: Need help solving a problem Pat Physics Forum 4 04-19-2004 08:33 PM

All times are GMT. The time now is 07:02 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.11493 seconds with 16 queries