| | |||||||
| Register | Search | Today's Posts | Mark Forums Read |
| Biology Forum Biology Forums. Ask questions and discuss the study of Biology. If you have Biology questions from your homework ask them here! |
| | LinkBack | Thread Tools | Display Modes |
|
#1
| |||||||||||
| |||||||||||
| oh well, no one answered my first question so im gonna try with the 2nd one You must subclone the coding region of gene X (see below) in the bacterial expression vector pQE60 using PCR. Write the sequence of two oligonucleotides that will allow you to clone the coding sequence in the vector. The coding sequence must be in frame with the ATG of the vector. The histidine tag must be present at the C-terminus of your recombinant protein. The oligos must be as short as possible but must hybridize with 20 nucleotides of the template srand. The start and stop codons of gene X are underlined. Coding sequence of gene X GTCGATCAAT ATGGAACATG TTTACTCCAA ACCACCGCAC ACCAATTATG GAAACCAAGC CGGAAAAGAA TTCCGGTGGA GAGCGAAAAA AAAGGATTCC GAATCGTGAA CTGCCAAAAA CATTTTGAAG CCAACGATTC CGACGTCATC CTCGCCACCC TAGCTAAATC AGGCACCACT TGGTTAAAAG CTCTTCTCTT TGCTCTCATT CACCGACACA AGTTCCCAGT TTCTGGCAAG CATCCTCTTC TGAAACAGCA GTAGCAGCGT TTAAAGGGAA GTTTATT Oligo #1 5’ ________________________________________… Oligo #2 5’ ________________________________________… Nco1 = CCATGG BamH1 = GGATCC BglII = AGATCT HindIII = AAGCTT Nco1 BamH1 BglII HindIII pQE60 (RBS)CCATGGGAGGATCCAGATCT(blackbox) TAAGCTTCCGCATAATTAGCTGAG Additional Details underlined in gene x : the first ATG and the last TAA underlined in vector: the first ATG |
| Tags |
| biology , molecular , question |
| Thread Tools | |
| Display Modes | |
|
|
| | ||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| a question: biochemistry versus molecular biology | korazon | Science Careers | 4 | 12-12-2009 04:14 AM |
| Graduate Program in Molecular Plant Biology - Research Assistantships | ASN Reddy | Arabidopsis and Plant Biology | 0 | 10-16-2007 09:11 PM |
| From the Editor - Journal of Cell and Molecular Biology | malitufekci | Cell Biology and Cell Culture | 0 | 08-17-2007 08:57 AM |
| 4 Post doc positions within Plant Biology at the University ofCopenhagen | Søren Bak | Arabidopsis and Plant Biology | 0 | 03-25-2007 08:52 PM |
| Assistant Professor in Plat Molecular Biology at The Universityof Texas at Austin | Chen, Z. Jeffrey | Arabidopsis and Plant Biology | 0 | 11-15-2006 10:40 PM |