Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > General Science Forums > Biology Forum
Register Search Today's Posts Mark Forums Read

Biology Forum Biology Forums. Ask questions and discuss the study of Biology. If you have Biology questions from your homework ask them here!


another molecular biology question

another molecular biology question - Biology Forum

another molecular biology question - Biology Forums. Ask questions and discuss the study of Biology. If you have Biology questions from your homework ask them here!


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 09-29-2012, 12:07 PM
boa boa is offline
Pipette Filler
Points: 17, Level: 1 Points: 17, Level: 1 Points: 17, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Sep 2012
Posts: 3
Thanks: 0
Thanked 0 Times in 0 Posts
Default another molecular biology question



oh well, no one answered my first question so im gonna try with the 2nd one

You must subclone the
coding region of gene X (see below) in the bacterial expression vector pQE60 using PCR. Write the sequence of two oligonucleotides that will allow you to clone the coding
sequence in the vector. The coding sequence must be in frame with the ATG of the vector. The histidine tag must be present
at the C-terminus of your recombinant protein. The oligos must be as short as possible but must
hybridize with 20 nucleotides of the template srand. The start and stop codons of gene X are
underlined.
Coding sequence of gene X
GTCGATCAAT ATGGAACATG TTTACTCCAA ACCACCGCAC ACCAATTATG
GAAACCAAGC CGGAAAAGAA TTCCGGTGGA GAGCGAAAAA AAAGGATTCC
GAATCGTGAA CTGCCAAAAA CATTTTGAAG CCAACGATTC CGACGTCATC
CTCGCCACCC TAGCTAAATC AGGCACCACT TGGTTAAAAG CTCTTCTCTT
TGCTCTCATT CACCGACACA AGTTCCCAGT TTCTGGCAAG CATCCTCTTC
TGAAACAGCA GTAGCAGCGT TTAAAGGGAA GTTTATT
Oligo #1 5’ ________________________________________…
Oligo #2 5’ ________________________________________…
Nco1 = CCATGG BamH1 = GGATCC BglII = AGATCT HindIII = AAGCTT
Nco1 BamH1 BglII HindIII
pQE60 (RBS)CCATGGGAGGATCCAGATCT(blackbox) TAAGCTTCCGCATAATTAGCTGAG

Additional Details
underlined in gene x : the first ATG and the last TAA
underlined in vector: the first ATG
Reply With Quote
Reply

Tags
biology , molecular , question


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
a question: biochemistry versus molecular biology korazon Science Careers 4 12-12-2009 05:14 AM
Graduate Program in Molecular Plant Biology - Research Assistantships ASN Reddy Arabidopsis and Plant Biology 0 10-16-2007 09:11 PM
From the Editor - Journal of Cell and Molecular Biology malitufekci Cell Biology and Cell Culture 0 08-17-2007 08:57 AM
4 Post doc positions within Plant Biology at the University ofCopenhagen Søren Bak Arabidopsis and Plant Biology 0 03-25-2007 08:52 PM
Assistant Professor in Plat Molecular Biology at The Universityof Texas at Austin Chen, Z. Jeffrey Arabidopsis and Plant Biology 0 11-15-2006 11:40 PM


All times are GMT. The time now is 06:26 AM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.11180 seconds with 16 queries