![]() |
another molecular biology question oh well, no one answered my first question so im gonna try with the 2nd one :) You must subclone the coding region of gene X (see below) in the bacterial expression vector pQE60 using PCR. Write the sequence of two oligonucleotides that will allow you to clone the coding sequence in the vector. The coding sequence must be in frame with the ATG of the vector. The histidine tag must be present at the C-terminus of your recombinant protein. The oligos must be as short as possible but must hybridize with 20 nucleotides of the template srand. The start and stop codons of gene X are underlined. Coding sequence of gene X GTCGATCAAT ATGGAACATG TTTACTCCAA ACCACCGCAC ACCAATTATG GAAACCAAGC CGGAAAAGAA TTCCGGTGGA GAGCGAAAAA AAAGGATTCC GAATCGTGAA CTGCCAAAAA CATTTTGAAG CCAACGATTC CGACGTCATC CTCGCCACCC TAGCTAAATC AGGCACCACT TGGTTAAAAG CTCTTCTCTT TGCTCTCATT CACCGACACA AGTTCCCAGT TTCTGGCAAG CATCCTCTTC TGAAACAGCA GTAGCAGCGT TTAAAGGGAA GTTTATT Oligo #1 5’ ________________________________________… Oligo #2 5’ ________________________________________… Nco1 = CCATGG BamH1 = GGATCC BglII = AGATCT HindIII = AAGCTT Nco1 BamH1 BglII HindIII pQE60 (RBS)CCATGGGAGGATCCAGATCT(blackbox) TAAGCTTCCGCATAATTAGCTGAG Additional Details underlined in gene x : the first ATG and the last TAA underlined in vector: the first ATG |
| All times are GMT. The time now is 09:53 AM. |
Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved