Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (http://www.molecularstation.com/forum/)
-   Biology Forum (http://www.molecularstation.com/forum/biology-forum/)
-   -   another molecular biology question (http://www.molecularstation.com/forum/biology-forum/86554-another-molecular-biology-question.html)

boa 09-29-2012 12:07 PM

another molecular biology question
 
oh well, no one answered my first question so im gonna try with the 2nd one :)

You must subclone the
coding region of gene X (see below) in the bacterial expression vector pQE60 using PCR. Write the sequence of two oligonucleotides that will allow you to clone the coding
sequence in the vector. The coding sequence must be in frame with the ATG of the vector. The histidine tag must be present
at the C-terminus of your recombinant protein. The oligos must be as short as possible but must
hybridize with 20 nucleotides of the template srand. The start and stop codons of gene X are
underlined.
Coding sequence of gene X
GTCGATCAAT ATGGAACATG TTTACTCCAA ACCACCGCAC ACCAATTATG
GAAACCAAGC CGGAAAAGAA TTCCGGTGGA GAGCGAAAAA AAAGGATTCC
GAATCGTGAA CTGCCAAAAA CATTTTGAAG CCAACGATTC CGACGTCATC
CTCGCCACCC TAGCTAAATC AGGCACCACT TGGTTAAAAG CTCTTCTCTT
TGCTCTCATT CACCGACACA AGTTCCCAGT TTCTGGCAAG CATCCTCTTC
TGAAACAGCA GTAGCAGCGT TTAAAGGGAA GTTTATT
Oligo #1 5 ________________________________________
Oligo #2 5 ________________________________________
Nco1 = CCATGG BamH1 = GGATCC BglII = AGATCT HindIII = AAGCTT
Nco1 BamH1 BglII HindIII
pQE60 (RBS)CCATGGGAGGATCCAGATCT(blackbox) TAAGCTTCCGCATAATTAGCTGAG

Additional Details
underlined in gene x : the first ATG and the last TAA
underlined in vector: the first ATG


All times are GMT. The time now is 10:00 AM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.09151 seconds with 11 queries