| | |||||||
| Register | Search | Today's Posts | Mark Forums Read |
| Bioinformatics Have questions about bioinformatic tools or databases? Post questions here. Discuss and post interesting bioinformatics information. |
| | LinkBack | Thread Tools | Display Modes |
|
#1
| |||||||||||
| |||||||||||
| Hi guys, I have this sequence which I have inputted into the TFSEARCH database, using "veterbrate" and a threshold score of 90. : ctgggctcctaacgaaggccctggggcccggtgggatgaaaagccctatt aggtagcaaa cagctgtcactagaggggttgaggcccccttctcccctgcctgacgacga cggcggcagg aggctgggagcggcggcgcatgctgggagccaaaaaaggctgtgactcac acctgactca tgacgtcatggtgactcactcacggggcactcccgtgcccagagcccgcg tgttcaggcg aggaaggtgcatgctgggagcggcggcgcatgctgggagctgtagtctgc gacgcaactc ggccgaggtggctccctggtccctgaagctcccagagcccgcgtgttcag gcggtcccga gctcccagcccagttgctgctggtggtttggcaactggctgcagagatgc tgccctgaag aattgtgctgaatgtgggtaatttagattacttgtatcttagacagtggc tccctggtcg ggaatcagattatctaacagatttctcaggttccaagccgctgaatgtgg ctgaatgtgg acaaaaacctgattcctcgtaagggggcaaggcccaggattttctctatt tgatgtgttc cttccagtttttcagatggggccacgctggaagaaagaactagaagagtc cagtttttcg caccccggcccgagcctcaccggctggaggactgaacgcctgccggccct ccgggtatga gcggaggccgggatagccctgggacaggtgttgcccggaaggaaaaaata gggaatttcc cgccgatcacgtgaccgggagcctatggggcactcccgtgcgacgtccac tagccaatca gtggctgacgtcatcgtgacgtcacgaagggggcgggggccacaggggcg gggcccccac gcccggtatataaagccctggttaccaatgggagactagcgggccggcgt actggcctgg tccagcacctgcggggccctcgggcttggagggctgggccgggcggggaa cgggcggggc gggccggaggcggcggcggctgactcgccttctctccggggctgcgaccc cgaggcaacc ggctgcagatgggagcccgcggagccgaggatgcgggcgggccggggcgc gacgccggcg agggagctgttccgggacgccgccttccccgccgcggactcctcgctctt ctgcgacttg tctacgccgctggcccagttccgcgaggacatcacgtggaggcggcccca ggtggggccg tgtggggtgcggtgggcgccgtttctggtttctgagatctccgctcctcg cagggagcgg ggcggggtgggcggccagggtagctccgaacgcagggtccgccgttgttc tcctcagaag tgggcgcccggccccctcttttcgtacctccttcatacccccgcccagaa cgagcaggac tcggcgctaccctaaggacgctaaactaggtcgtggcctccgcctgcgag agctccaatc caggaggctcagagcgctgcgagaggcgttttaacagagccccaaaaccc cgccccacct I've been told to determine the positions of the AP1 and CREB binding sites (start and end) and asked "what does their position relative to the start site of transcription potentially indicate about their function in enabling gene transcription to take place (use the correct notation relative to initiating nucleotide)" I'm unsure of how to state the positioning - I've been simply counting the position range for each molecule i.e. 191-200; 166-170 etc etc. but this is taking forever =\ and am beginning to doubt if that is what is meant to be done? Also |
|
#2
| |||||||||||
| |||||||||||
| Quote:
CREB (TGACGTCA) at 181-188, 857, 864 Where is the transcription start site located??? There is a match for TATA-binding protein at 906-920. It would be necessary to know were the TSS is to interpret the location of the binding sites. |
| Tags |
| ap1 , binding , calpain , creb , determining , positions , sites |
| Thread Tools | |
| Display Modes | |
|
|
| | ||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| Identifying a protein binding site in a particular gene's promoter region | minimal | Bioinformatics | 2 | 09-14-2011 09:42 PM |
| a Ca-Mg binding sites prediction problem | liuhuicengsiwei | Biochemistry Forum | 0 | 04-25-2010 02:42 AM |
| how to find transcription factors binding sites on a promoter | kalai | Bioinformatics | 2 | 03-11-2009 07:09 AM |
| IUPAC consensus of binding sites | Elena Grassi | Yeast Forum | 0 | 07-20-2007 01:46 PM |
| Transcription Factor Binding Sites and DNA-Direction | ALiX | Protein Forum | 0 | 04-05-2007 11:43 AM |