Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Bioinformatics
Register Search Today's Posts Mark Forums Read

Bioinformatics Have questions about bioinformatic tools or databases? Post questions here. Discuss and post interesting bioinformatics information.


Calpain 10 - Determining positions AP1 CREB binding sites

Calpain 10 - Determining positions AP1 CREB binding sites - Bioinformatics

Calpain 10 - Determining positions AP1 CREB binding sites - Have questions about bioinformatic tools or databases? Post questions here. Discuss and post interesting bioinformatics information.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 12-01-2011, 08:43 PM
Pipette Filler
Points: 83, Level: 1 Points: 83, Level: 1 Points: 83, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2011
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Exclamation Calpain 10 - Determining positions AP1 CREB binding sites



Hi guys,

I have this sequence which I have inputted into the TFSEARCH database, using "veterbrate" and a threshold score of 90.

:

ctgggctcctaacgaaggccctggggcccggtgggatgaaaagccctatt aggtagcaaa
cagctgtcactagaggggttgaggcccccttctcccctgcctgacgacga cggcggcagg
aggctgggagcggcggcgcatgctgggagccaaaaaaggctgtgactcac acctgactca
tgacgtcatggtgactcactcacggggcactcccgtgcccagagcccgcg tgttcaggcg
aggaaggtgcatgctgggagcggcggcgcatgctgggagctgtagtctgc gacgcaactc
ggccgaggtggctccctggtccctgaagctcccagagcccgcgtgttcag gcggtcccga
gctcccagcccagttgctgctggtggtttggcaactggctgcagagatgc tgccctgaag
aattgtgctgaatgtgggtaatttagattacttgtatcttagacagtggc tccctggtcg
ggaatcagattatctaacagatttctcaggttccaagccgctgaatgtgg ctgaatgtgg
acaaaaacctgattcctcgtaagggggcaaggcccaggattttctctatt tgatgtgttc
cttccagtttttcagatggggccacgctggaagaaagaactagaagagtc cagtttttcg
caccccggcccgagcctcaccggctggaggactgaacgcctgccggccct ccgggtatga
gcggaggccgggatagccctgggacaggtgttgcccggaaggaaaaaata gggaatttcc
cgccgatcacgtgaccgggagcctatggggcactcccgtgcgacgtccac tagccaatca
gtggctgacgtcatcgtgacgtcacgaagggggcgggggccacaggggcg gggcccccac
gcccggtatataaagccctggttaccaatgggagactagcgggccggcgt actggcctgg
tccagcacctgcggggccctcgggcttggagggctgggccgggcggggaa cgggcggggc
gggccggaggcggcggcggctgactcgccttctctccggggctgcgaccc cgaggcaacc
ggctgcagatgggagcccgcggagccgaggatgcgggcgggccggggcgc gacgccggcg
agggagctgttccgggacgccgccttccccgccgcggactcctcgctctt ctgcgacttg
tctacgccgctggcccagttccgcgaggacatcacgtggaggcggcccca ggtggggccg
tgtggggtgcggtgggcgccgtttctggtttctgagatctccgctcctcg cagggagcgg
ggcggggtgggcggccagggtagctccgaacgcagggtccgccgttgttc tcctcagaag
tgggcgcccggccccctcttttcgtacctccttcatacccccgcccagaa cgagcaggac
tcggcgctaccctaaggacgctaaactaggtcgtggcctccgcctgcgag agctccaatc
caggaggctcagagcgctgcgagaggcgttttaacagagccccaaaaccc cgccccacct

I've been told to determine the positions of the AP1 and CREB binding sites (start and end) and asked "what does their position relative to the start site of transcription potentially indicate about their function in enabling gene transcription to take place (use the correct notation relative to initiating nucleotide)"

I'm unsure of how to state the positioning - I've been simply counting the position range for each molecule i.e. 191-200; 166-170 etc etc. but this is taking forever =\ and am beginning to doubt if that is what is meant to be done?

Also
Reply With Quote
  #2  
Old 12-02-2011, 01:12 PM
Graduate Student
Points: 1,231, Level: 20 Points: 1,231, Level: 20 Points: 1,231, Level: 20
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Jun 2011
Posts: 113
Thanks: 0
Thanked 16 Times in 13 Posts
Default Re: Calpain 10 - Determining positions AP1 CREB binding sites

Quote:
Originally Posted by Flowerful View Post
Hi guys,

I have this sequence which I have inputted into the TFSEARCH database, using "veterbrate" and a threshold score of 90.

:

ctgggctcctaacgaaggccctggggcccggtgggatgaaaagccctatt aggtagcaaa
cagctgtcactagaggggttgaggcccccttctcccctgcctgacgacga cggcggcagg
aggctgggagcggcggcgcatgctgggagccaaaaaaggctgtgactcac acctgactca
tgacgtcatggtgactcactcacggggcactcccgtgcccagagcccgcg tgttcaggcg
aggaaggtgcatgctgggagcggcggcgcatgctgggagctgtagtctgc gacgcaactc
ggccgaggtggctccctggtccctgaagctcccagagcccgcgtgttcag gcggtcccga
gctcccagcccagttgctgctggtggtttggcaactggctgcagagatgc tgccctgaag
aattgtgctgaatgtgggtaatttagattacttgtatcttagacagtggc tccctggtcg
ggaatcagattatctaacagatttctcaggttccaagccgctgaatgtgg ctgaatgtgg
acaaaaacctgattcctcgtaagggggcaaggcccaggattttctctatt tgatgtgttc
cttccagtttttcagatggggccacgctggaagaaagaactagaagagtc cagtttttcg
caccccggcccgagcctcaccggctggaggactgaacgcctgccggccct ccgggtatga
gcggaggccgggatagccctgggacaggtgttgcccggaaggaaaaaata gggaatttcc
cgccgatcacgtgaccgggagcctatggggcactcccgtgcgacgtccac tagccaatca
gtggctgacgtcatcgtgacgtcacgaagggggcgggggccacaggggcg gggcccccac
gcccggtatataaagccctggttaccaatgggagactagcgggccggcgt actggcctgg
tccagcacctgcggggccctcgggcttggagggctgggccgggcggggaa cgggcggggc
gggccggaggcggcggcggctgactcgccttctctccggggctgcgaccc cgaggcaacc
ggctgcagatgggagcccgcggagccgaggatgcgggcgggccggggcgc gacgccggcg
agggagctgttccgggacgccgccttccccgccgcggactcctcgctctt ctgcgacttg
tctacgccgctggcccagttccgcgaggacatcacgtggaggcggcccca ggtggggccg
tgtggggtgcggtgggcgccgtttctggtttctgagatctccgctcctcg cagggagcgg
ggcggggtgggcggccagggtagctccgaacgcagggtccgccgttgttc tcctcagaag
tgggcgcccggccccctcttttcgtacctccttcatacccccgcccagaa cgagcaggac
tcggcgctaccctaaggacgctaaactaggtcgtggcctccgcctgcgag agctccaatc
caggaggctcagagcgctgcgagaggcgttttaacagagccccaaaaccc cgccccacct

I've been told to determine the positions of the AP1 and CREB binding sites (start and end) and asked "what does their position relative to the start site of transcription potentially indicate about their function in enabling gene transcription to take place (use the correct notation relative to initiating nucleotide)"

I'm unsure of how to state the positioning - I've been simply counting the position range for each molecule i.e. 191-200; 166-170 etc etc. but this is taking forever = and am beginning to doubt if that is what is meant to be done?

Also
There are AP1 sites (TGANTCA) at 163-169, 174-180, 192-198

CREB (TGACGTCA) at 181-188, 857, 864

Where is the transcription start site located??? There is a match for TATA-binding protein at 906-920. It would be necessary to know were the TSS is to interpret the location of the binding sites.
Reply With Quote
Reply

Tags
ap1 , binding , calpain , creb , determining , positions , sites


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Identifying a protein binding site in a particular gene's promoter region minimal Bioinformatics 2 09-14-2011 09:42 PM
a Ca-Mg binding sites prediction problem liuhuicengsiwei Biochemistry Forum 0 04-25-2010 02:42 AM
how to find transcription factors binding sites on a promoter kalai Bioinformatics 2 03-11-2009 07:09 AM
IUPAC consensus of binding sites Elena Grassi Yeast Forum 0 07-20-2007 01:46 PM
Transcription Factor Binding Sites and DNA-Direction ALiX Protein Forum 0 04-05-2007 11:43 AM


All times are GMT. The time now is 01:32 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.52161 seconds with 16 queries