Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum

Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum (http://www.molecularstation.com/forum/)
-   Bioinformatics (http://www.molecularstation.com/forum/bioinformatics/)
-   -   Calpain 10 - Determining positions AP1 CREB binding sites (http://www.molecularstation.com/forum/bioinformatics/84200-calpain-10-determining-positions-ap1-creb-binding-sites.html)

Flowerful 12-01-2011 09:43 PM

Calpain 10 - Determining positions AP1 CREB binding sites
 
Hi guys,

I have this sequence which I have inputted into the TFSEARCH database, using "veterbrate" and a threshold score of 90.

:

ctgggctcctaacgaaggccctggggcccggtgggatgaaaagccctatt aggtagcaaa
cagctgtcactagaggggttgaggcccccttctcccctgcctgacgacga cggcggcagg
aggctgggagcggcggcgcatgctgggagccaaaaaaggctgtgactcac acctgactca
tgacgtcatggtgactcactcacggggcactcccgtgcccagagcccgcg tgttcaggcg
aggaaggtgcatgctgggagcggcggcgcatgctgggagctgtagtctgc gacgcaactc
ggccgaggtggctccctggtccctgaagctcccagagcccgcgtgttcag gcggtcccga
gctcccagcccagttgctgctggtggtttggcaactggctgcagagatgc tgccctgaag
aattgtgctgaatgtgggtaatttagattacttgtatcttagacagtggc tccctggtcg
ggaatcagattatctaacagatttctcaggttccaagccgctgaatgtgg ctgaatgtgg
acaaaaacctgattcctcgtaagggggcaaggcccaggattttctctatt tgatgtgttc
cttccagtttttcagatggggccacgctggaagaaagaactagaagagtc cagtttttcg
caccccggcccgagcctcaccggctggaggactgaacgcctgccggccct ccgggtatga
gcggaggccgggatagccctgggacaggtgttgcccggaaggaaaaaata gggaatttcc
cgccgatcacgtgaccgggagcctatggggcactcccgtgcgacgtccac tagccaatca
gtggctgacgtcatcgtgacgtcacgaagggggcgggggccacaggggcg gggcccccac
gcccggtatataaagccctggttaccaatgggagactagcgggccggcgt actggcctgg
tccagcacctgcggggccctcgggcttggagggctgggccgggcggggaa cgggcggggc
gggccggaggcggcggcggctgactcgccttctctccggggctgcgaccc cgaggcaacc
ggctgcagatgggagcccgcggagccgaggatgcgggcgggccggggcgc gacgccggcg
agggagctgttccgggacgccgccttccccgccgcggactcctcgctctt ctgcgacttg
tctacgccgctggcccagttccgcgaggacatcacgtggaggcggcccca ggtggggccg
tgtggggtgcggtgggcgccgtttctggtttctgagatctccgctcctcg cagggagcgg
ggcggggtgggcggccagggtagctccgaacgcagggtccgccgttgttc tcctcagaag
tgggcgcccggccccctcttttcgtacctccttcatacccccgcccagaa cgagcaggac
tcggcgctaccctaaggacgctaaactaggtcgtggcctccgcctgcgag agctccaatc
caggaggctcagagcgctgcgagaggcgttttaacagagccccaaaaccc cgccccacct

I've been told to determine the positions of the AP1 and CREB binding sites (start and end) and asked "what does their position relative to the start site of transcription potentially indicate about their function in enabling gene transcription to take place (use the correct notation relative to initiating nucleotide)"

I'm unsure of how to state the positioning - I've been simply counting the position range for each molecule i.e. 191-200; 166-170 etc etc. but this is taking forever =\ and am beginning to doubt if that is what is meant to be done?

Also

mmorgan 12-02-2011 02:12 PM

Re: Calpain 10 - Determining positions AP1 CREB binding sites
 
Quote:

Originally Posted by Flowerful (Post 437469)
Hi guys,

I have this sequence which I have inputted into the TFSEARCH database, using "veterbrate" and a threshold score of 90.

:

ctgggctcctaacgaaggccctggggcccggtgggatgaaaagccctatt aggtagcaaa
cagctgtcactagaggggttgaggcccccttctcccctgcctgacgacga cggcggcagg
aggctgggagcggcggcgcatgctgggagccaaaaaaggctgtgactcac acctgactca
tgacgtcatggtgactcactcacggggcactcccgtgcccagagcccgcg tgttcaggcg
aggaaggtgcatgctgggagcggcggcgcatgctgggagctgtagtctgc gacgcaactc
ggccgaggtggctccctggtccctgaagctcccagagcccgcgtgttcag gcggtcccga
gctcccagcccagttgctgctggtggtttggcaactggctgcagagatgc tgccctgaag
aattgtgctgaatgtgggtaatttagattacttgtatcttagacagtggc tccctggtcg
ggaatcagattatctaacagatttctcaggttccaagccgctgaatgtgg ctgaatgtgg
acaaaaacctgattcctcgtaagggggcaaggcccaggattttctctatt tgatgtgttc
cttccagtttttcagatggggccacgctggaagaaagaactagaagagtc cagtttttcg
caccccggcccgagcctcaccggctggaggactgaacgcctgccggccct ccgggtatga
gcggaggccgggatagccctgggacaggtgttgcccggaaggaaaaaata gggaatttcc
cgccgatcacgtgaccgggagcctatggggcactcccgtgcgacgtccac tagccaatca
gtggctgacgtcatcgtgacgtcacgaagggggcgggggccacaggggcg gggcccccac
gcccggtatataaagccctggttaccaatgggagactagcgggccggcgt actggcctgg
tccagcacctgcggggccctcgggcttggagggctgggccgggcggggaa cgggcggggc
gggccggaggcggcggcggctgactcgccttctctccggggctgcgaccc cgaggcaacc
ggctgcagatgggagcccgcggagccgaggatgcgggcgggccggggcgc gacgccggcg
agggagctgttccgggacgccgccttccccgccgcggactcctcgctctt ctgcgacttg
tctacgccgctggcccagttccgcgaggacatcacgtggaggcggcccca ggtggggccg
tgtggggtgcggtgggcgccgtttctggtttctgagatctccgctcctcg cagggagcgg
ggcggggtgggcggccagggtagctccgaacgcagggtccgccgttgttc tcctcagaag
tgggcgcccggccccctcttttcgtacctccttcatacccccgcccagaa cgagcaggac
tcggcgctaccctaaggacgctaaactaggtcgtggcctccgcctgcgag agctccaatc
caggaggctcagagcgctgcgagaggcgttttaacagagccccaaaaccc cgccccacct

I've been told to determine the positions of the AP1 and CREB binding sites (start and end) and asked "what does their position relative to the start site of transcription potentially indicate about their function in enabling gene transcription to take place (use the correct notation relative to initiating nucleotide)"

I'm unsure of how to state the positioning - I've been simply counting the position range for each molecule i.e. 191-200; 166-170 etc etc. but this is taking forever = and am beginning to doubt if that is what is meant to be done?

Also

There are AP1 sites (TGANTCA) at 163-169, 174-180, 192-198

CREB (TGACGTCA) at 181-188, 857, 864

Where is the transcription start site located??? There is a match for TATA-binding protein at 906-920. It would be necessary to know were the TSS is to interpret the location of the binding sites.


All times are GMT. The time now is 06:12 PM.

Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved

Page generated in 0.09584 seconds with 11 queries