Go Back   Science Forums Biology Forum Molecular Biology Forum Physics Chemistry Forum > Molecular Research Topics Forum > Bioinformatics
Register Search Today's Posts Mark Forums Read

Bioinformatics Have questions about bioinformatic tools or databases? Post questions here. Discuss and post interesting bioinformatics information.


Can anyone help me to correct my primer design?

Can anyone help me to correct my primer design? - Bioinformatics

Can anyone help me to correct my primer design? - Have questions about bioinformatic tools or databases? Post questions here. Discuss and post interesting bioinformatics information.


Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 12-12-2009, 11:21 AM
Pipette Filler
Points: 8, Level: 1 Points: 8, Level: 1 Points: 8, Level: 1
Activity: 0% Activity: 0% Activity: 0%
 
Join Date: Dec 2009
Posts: 2
Thanks: 0
Thanked 0 Times in 0 Posts
Default Can anyone help me to correct my primer design?



Hello everyone, I am just starting learning to design primer. But I still have problem with reverse primer design.
If I have sequence like this
5’ GATAGTGGTTGCGTTGTGAGCTGGAAAAAAAAGAACTGAAATGTGGCAGTTGGTCAACTCCTTGGTCACAGCT 3’
If I use start codon ATG and ACTAGT as restriction enzyme, my forward primer should be 5’ ACTAGT ATG GAT AGT GGT TGC GTT GTG 3’
If I use TAA as stop codon and CGGCCG as restriction enzyme, my reverse primer should be 5’ GCCGGC AAT AGC TGT GAC CAA GGA GTT 3’
Please help and I will be happy to have your suggestion. Thank you.
Reply With Quote
Reply

Tags
correct , design , primer , primers


Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Trackbacks are On
Pingbacks are On
Refbacks are On

Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
Can anyone help me to correct my primer design? confusing PCR - Polymerase Chain Reaction Forum 2 01-12-2010 09:12 PM
Bad primer design ? How can I know ? surt Bioinformatics 4 10-07-2009 07:24 AM
How to design primer? af malik PCR - Polymerase Chain Reaction Forum 3 01-29-2009 10:11 AM
Primer design software Josh Levin Protocols and Methods Forum 0 01-08-2009 01:31 PM
Diferential primer design Yoram Gerchman Protocols and Methods Forum 1 09-01-2007 01:56 AM


All times are GMT. The time now is 05:41 PM.


Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Copyright 2005 - 2012 Molecular Station | All Rights Reserved
Page generated in 0.97277 seconds with 16 queries