| | |||||||
| Register | Search | Today's Posts | Mark Forums Read |
| Bioinformatics Have questions about bioinformatic tools or databases? Post questions here. Discuss and post interesting bioinformatics information. |
| | LinkBack | Thread Tools | Display Modes |
|
#1
| |||||||||||
| |||||||||||
| Hello everyone, I am just starting learning to design primer. But I still have problem with reverse primer design. If I have sequence like this 5’ GATAGTGGTTGCGTTGTGAGCTGGAAAAAAAAGAACTGAAATGTGGCAGTTGGTCAACTCCTTGGTCACAGCT 3’ If I use start codon ATG and ACTAGT as restriction enzyme, my forward primer should be 5’ ACTAGT ATG GAT AGT GGT TGC GTT GTG 3’ If I use TAA as stop codon and CGGCCG as restriction enzyme, my reverse primer should be 5’ GCCGGC AAT AGC TGT GAC CAA GGA GTT 3’ Please help and I will be happy to have your suggestion. Thank you. |
| Tags |
| correct , design , primer , primers |
| Thread Tools | |
| Display Modes | |
|
|
| | ||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| Can anyone help me to correct my primer design? | confusing | PCR - Polymerase Chain Reaction Forum | 2 | 01-12-2010 09:12 PM |
| Bad primer design ? How can I know ? | surt | Bioinformatics | 4 | 10-07-2009 07:24 AM |
| How to design primer? | af malik | PCR - Polymerase Chain Reaction Forum | 3 | 01-29-2009 10:11 AM |
| Primer design software | Josh Levin | Protocols and Methods Forum | 0 | 01-08-2009 01:31 PM |
| Diferential primer design | Yoram Gerchman | Protocols and Methods Forum | 1 | 09-01-2007 01:56 AM |